View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1994_low_20 (Length: 236)
Name: NF1994_low_20
Description: NF1994
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1994_low_20 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 53; Significance: 1e-21; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 160 - 220
Target Start/End: Complemental strand, 24498384 - 24498324
Alignment:
| Q |
160 |
ctctttaaatgatatggcacgctcattaatgacctgtaatgtacatatcattgcttacatg |
220 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
24498384 |
ctctttaaatgatatggcgcgctcattaatgacctgtaatttacatatcattgcttacatg |
24498324 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 1 - 57
Target Start/End: Complemental strand, 24498561 - 24498505
Alignment:
| Q |
1 |
ctaacttgttgcattcatgtagttatgcgtttgagatcgtttaatattttaaaaatg |
57 |
Q |
| |
|
|||||||||||||||||||||||||||||| || ||||||||| ||||||||||||| |
|
|
| T |
24498561 |
ctaacttgttgcattcatgtagttatgcgtctgtgatcgtttagtattttaaaaatg |
24498505 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University