View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19950_high_11 (Length: 252)
Name: NF19950_high_11
Description: NF19950
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19950_high_11 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 180; Significance: 3e-97; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 180; E-Value: 3e-97
Query Start/End: Original strand, 1 - 184
Target Start/End: Complemental strand, 44590765 - 44590582
Alignment:
| Q |
1 |
ttgctcatattgaccatgggaagtccacgttagcggataagttgcttcaggttactggtaccgtgccacagcgagaaatgaaggaacagtttcttgataa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44590765 |
ttgctcatattgaccatgggaagtccacgttagcggataagttgcttcaggttactggtactgtgccacagcgagaaatgaaggaacagtttcttgataa |
44590666 |
T |
 |
| Q |
101 |
tatggatttagagagagaaagaggcatcactattaagcttcaggttcatgttttccttttcttatcttcatcattatatatata |
184 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44590665 |
tatggatttagagagagaaagaggcatcactattaagcttcaggttcatgttttccttttcttatcttcatcattatatatata |
44590582 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 30; Significance: 0.00000009; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 178 - 211
Target Start/End: Complemental strand, 7232597 - 7232564
Alignment:
| Q |
178 |
atatatacacgtgaaaatggtggttaattgtgtt |
211 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||| |
|
|
| T |
7232597 |
atatatacacttgaaaatggtggttaattgtgtt |
7232564 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University