View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19950_high_2 (Length: 411)
Name: NF19950_high_2
Description: NF19950
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19950_high_2 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 372; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 372; E-Value: 0
Query Start/End: Original strand, 1 - 396
Target Start/End: Complemental strand, 22793067 - 22792672
Alignment:
| Q |
1 |
tgtctgttgaaatgctgatagagcatctctcaaatcctctgaaactctcgggattcctctaaactcccttccgtcatcggaactttcaccggaacttttc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||| |||||||||||||||||||||||| || |
|
|
| T |
22793067 |
tgtctgttgaaatgctgatagagcatctctcaaatcctccgaaactcttgggattcctctaaactcccttccctcatcggaactttcaccggaacttctc |
22792968 |
T |
 |
| Q |
101 |
attgaattgttcgagtccctccttgaaccaccaccagagcttctaactgccactccttgtggcttccccgtctccgaatcagttttcaacactaaccccc |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22792967 |
attgaattgttcgagtccctccttgaaccaccaccggagcttctaactgccactccttgtggcttccccgtctccgaatcagttttcaacactaaccccc |
22792868 |
T |
 |
| Q |
201 |
actccgctgctcgttgtgctgcagcggagccaggttcgttggaaactgacggagaggtggtttctttgagtgccatccaggaagtggcgacggggacttc |
300 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22792867 |
actctgctgctcgttgtgctgcagcggagccaggttcgttggaaactgacggagaggtggtttctttgagtgccatccaggaagtggcgacggggacttc |
22792768 |
T |
 |
| Q |
301 |
atcagagttgatggagtcacgcgtcggttgttgtggagtttcgttgggtcgtgagtttgttgtccaagtgttccatgaattgattggatttggatt |
396 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22792767 |
atcagagttgatggagtcacgcgtcggttgttgtggagtttcgttgggtcgtgagtttgttgtccaagtgttccatgaattgattggatttggatt |
22792672 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 5 - 51
Target Start/End: Complemental strand, 40954574 - 40954528
Alignment:
| Q |
5 |
tgttgaaatgctgatagagcatctctcaaatcctctgaaactctcgg |
51 |
Q |
| |
|
|||||||| ||||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
40954574 |
tgttgaaaagctgataaagcatctttcaaatcctctgaaactctcgg |
40954528 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University