View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19950_high_9 (Length: 279)
Name: NF19950_high_9
Description: NF19950
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19950_high_9 |
 | |
|
| [»] scaffold2116 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold2116 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: scaffold2116
Description:
Target: scaffold2116; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 16 - 267
Target Start/End: Original strand, 490 - 740
Alignment:
| Q |
16 |
atgatgaaacaaagagcatgatgatagttgcacaaataaattctgaagctatgagtacacaccatggtagttgcattctatattcatgggaataaaattt |
115 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
490 |
atgatgaaacgaagagcatgatgatagttgcacaaataaattctgaagctatgagtacacaccatagtagttgcattctatattcatgggaataaaattt |
589 |
T |
|
| Q |
116 |
cacaccctaaaaacatggaaatataaaagtaaaaactcaagcgaacttgtaattttataaacttcttattaaacatgaaaatgttatattttcaaccaac |
215 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
590 |
cacaccctcaaaacatggaaatataaaagtaaaaactcaagcgaacttgtaattttataaacttc-tattaaacatgaaaatgttatattttcaaccaac |
688 |
T |
|
| Q |
216 |
ttttccgagaatatttataaaaaccatgaaacaattcatcctaatttatatt |
267 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||| ||||||||||||||||| |
|
|
| T |
689 |
ttttccgagaatatttataagaaccatgaaacaaatcatcctaatttatatt |
740 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University