View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19950_low_12 (Length: 251)
Name: NF19950_low_12
Description: NF19950
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19950_low_12 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 231; Significance: 1e-127; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 1 - 235
Target Start/End: Complemental strand, 43411530 - 43411296
Alignment:
| Q |
1 |
aagggatggaggcataaaatccagcttgatatccaaattccctattgccctacaaaatttgacaaaaattaattaaaatacattagaatactcgatcata |
100 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43411530 |
aagggatgtaggcataaaatccagcttgatatccaaattccctattgccctacaaaatttgacaaaaattaattaaaatacattagaatactcgatcata |
43411431 |
T |
 |
| Q |
101 |
gttttccatgaaacaaaatacttattggtaaagcagcctatttgcaaaatcaatgataaaaactatctatccgaagaagttaaataaccgaggctcaaac |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43411430 |
gttttccatgaaacaaaatacttattggtaaagcagcctatttgcaaaatcaatgataaaaactatctatccgaagaagttaaataaccgaggctcaaac |
43411331 |
T |
 |
| Q |
201 |
ccaatgaaagagaaaaatctaacataacaacttat |
235 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
43411330 |
ccaatgaaagagaaaaatctaacataacaacttat |
43411296 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 44; Significance: 4e-16; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 1 - 48
Target Start/End: Original strand, 27953489 - 27953536
Alignment:
| Q |
1 |
aagggatggaggcataaaatccagcttgatatccaaattccctattgc |
48 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27953489 |
aagggatgaaggcataaaatccagcttgatatccaaattccctattgc |
27953536 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University