View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19951_high_21 (Length: 412)

Name: NF19951_high_21
Description: NF19951
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19951_high_21
NF19951_high_21
[»] chr7 (2 HSPs)
chr7 (1-92)||(22550758-22550849)
chr7 (339-412)||(22550307-22550380)


Alignment Details
Target: chr7 (Bit Score: 68; Significance: 3e-30; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 68; E-Value: 3e-30
Query Start/End: Original strand, 1 - 92
Target Start/End: Complemental strand, 22550849 - 22550758
Alignment:
1 tattccatatacgattattaggtataccggtttctattatactgaacaatatctgtacgattccggtattccatatacgattatatatagga 92  Q
    |||||||||||||||||| ||||| ||||||||||||||||| |||||||||||||| |||||||||||||  |||||||||||||||||||    
22550849 tattccatatacgattataaggtacaccggtttctattataccgaacaatatctgtatgattccggtattctgtatacgattatatatagga 22550758  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 339 - 412
Target Start/End: Complemental strand, 22550380 - 22550307
Alignment:
339 gtcagggctggtggtttgcaagacaaagagggaggtatccgtgaactcgtcatagggaaggacgatgagcttct 412  Q
    ||||| |||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||    
22550380 gtcagagctggtggcttgcaagacaaggagggaggtatccgtgaactcgtcatagggaaggacgatgagcttct 22550307  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University