View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19951_high_48 (Length: 272)
Name: NF19951_high_48
Description: NF19951
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19951_high_48 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 129; Significance: 8e-67; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 129; E-Value: 8e-67
Query Start/End: Original strand, 35 - 240
Target Start/End: Original strand, 52850454 - 52850658
Alignment:
| Q |
35 |
ttcttaaaaagatcttataattagggaaggagataacgtataagatttgggattggaaccggatacaccacagnnnnnnnntctatagtttgatatcatg |
134 |
Q |
| |
|
|||| |||||||||||||||||| ||| |||| ||| || ||| ||||||||| ||||||||||||||| || |||||||||||||||||| |
|
|
| T |
52850454 |
ttctcaaaaagatcttataattaaggacggaggtaatatacaaggtttgggattcgaaccggatacaccatagaaaaaaa-tctatagtttgatatcatc |
52850552 |
T |
|
| Q |
135 |
tcgcgacaaagttcaaatattgatgatacaagattttagtcagtggaatgtcacttgaaattgtacggctcctgtaattttctttggtaaacttgatatg |
234 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52850553 |
tcgcgacaaagttcaaatattgatgatacaagattttagtccgtggaatgtcacttgaaattgtacggctcctgtaattttctttggtaaacttgatatg |
52850652 |
T |
|
| Q |
235 |
atacta |
240 |
Q |
| |
|
|||||| |
|
|
| T |
52850653 |
atacta |
52850658 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University