View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19951_high_59 (Length: 250)
Name: NF19951_high_59
Description: NF19951
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19951_high_59 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 172; Significance: 2e-92; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 172; E-Value: 2e-92
Query Start/End: Original strand, 1 - 239
Target Start/End: Complemental strand, 45652470 - 45652210
Alignment:
| Q |
1 |
tatggcgttaaatattgttgtgg----tagtagtgtaaaattgtggtcttcaatacttgtatcatatgtctttaacaatgttgaaagcttctttctcttg |
96 |
Q |
| |
|
||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45652470 |
tatggtgttaaatattgttgtggccggtagtagtgtaaaattgtggtcttcaatacttgtatcatatgtctttaacaatgttgaaagcttctttctcttg |
45652371 |
T |
|
| Q |
97 |
aa----------------ccttttaagtttgctttgccttttat--gtgtaaatggcagtcattagtattccaaaattctataagattgggactatgaag |
178 |
Q |
| |
|
|| |||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
45652370 |
aattcaaatatgctcaaaccttttaagtttgctttgccttttatttgtgtaaatggcagtcattagtactccaaaattctataagattgggactatgaag |
45652271 |
T |
|
| Q |
179 |
tgtatctagtaagatcagtctaacaacttaggattagaacaaaacctatttaatctttcat |
239 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45652270 |
tgtatctagtaagatcagtctaacaacttaggattagaacaaaacctatttaatctttcat |
45652210 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 58
Target Start/End: Complemental strand, 31523863 - 31523806
Alignment:
| Q |
1 |
tatggcgttaaatattgttgtggtagtagtgtaaaattgtggtcttcaatacttgtat |
58 |
Q |
| |
|
||||| |||||||||||| ||| ||| |||||||||| ||||||||||||||||||| |
|
|
| T |
31523863 |
tatggtgttaaatattgtagtgtcagtggtgtaaaattttggtcttcaatacttgtat |
31523806 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University