View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19951_high_65 (Length: 244)
Name: NF19951_high_65
Description: NF19951
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19951_high_65 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 2 - 228
Target Start/End: Complemental strand, 16453102 - 16452876
Alignment:
| Q |
2 |
aataactgaatttgaatcccaaatggagtaaatgactaaagaatccagaagaaatattaaccttgactctttgccgtggtctctccattgaatttgaatc |
101 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16453102 |
aataactgaatttgaatcccaaatggagtaaatgactaaagaatccagaagaaatattaaccttgactctttgccgtggtctctccattgaatttgaatc |
16453003 |
T |
|
| Q |
102 |
aaaattcacacttatcaatgtttgtggaggatggaattggacatctcttggaccacatgtttgttcatatagcacatggattccgctaaacttagcaacc |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16453002 |
aaaattcacacttatcaatgtttgtggaggatggaattggacatctcttggaccacatgtttgttcatatagcacatggattccgctaaacttagcaacc |
16452903 |
T |
|
| Q |
202 |
tctcttatagagtcctcgttgtttgtt |
228 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
16452902 |
tctcttatagagtcctcgttgtttgtt |
16452876 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University