View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19951_high_66 (Length: 242)
Name: NF19951_high_66
Description: NF19951
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19951_high_66 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 177; Significance: 2e-95; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 23 - 228
Target Start/End: Complemental strand, 34835646 - 34835441
Alignment:
| Q |
23 |
ttatagatgggcttctgtaagtacatttcatgctttacacnnnnnnncttcaatttattaagatcaagatgatttcaattgattcatttgttgaacagat |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34835646 |
ttatagatgggcttctgtaagtacatttcatgctttacactttttttcttcaatttattaagatcaagatgatttcaattgattcatttgttgaacagat |
34835547 |
T |
|
| Q |
123 |
gcagaccaagggagatgctttgcaaacagaatctcaactgctgagtacatttgattatgcttggaacacaattaataacggtccacgacgtccaggtgat |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||| |
|
|
| T |
34835546 |
gcagaccaagggagatgctttgcaaacagaatctcaactgctgagtacatttgattatgcttggaacacaattaataacggtccacggcgtccgggtgat |
34835447 |
T |
|
| Q |
223 |
attctt |
228 |
Q |
| |
|
|||||| |
|
|
| T |
34835446 |
attctt |
34835441 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 23 - 55
Target Start/End: Complemental strand, 34821404 - 34821372
Alignment:
| Q |
23 |
ttatagatgggcttctgtaagtacatttcatgc |
55 |
Q |
| |
|
||||||||||||||||||||||||| ||||||| |
|
|
| T |
34821404 |
ttatagatgggcttctgtaagtacacttcatgc |
34821372 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 113 - 194
Target Start/End: Original strand, 35336285 - 35336366
Alignment:
| Q |
113 |
ttgaacagatgcagaccaagggagatgctttgcaaacagaatctcaactgctgagtacatttgattatgcttggaacacaat |
194 |
Q |
| |
|
||||||||||||| | |||||||||| || ||||||||| || ||||| ||||||||||||||||| ||||||||||| |
|
|
| T |
35336285 |
ttgaacagatgcaaaatgagggagatgccctgagaacagaatcacagctgcttagtacatttgattatgcatggaacacaat |
35336366 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University