View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19951_high_76 (Length: 221)
Name: NF19951_high_76
Description: NF19951
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19951_high_76 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 182; Significance: 1e-98; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 182; E-Value: 1e-98
Query Start/End: Original strand, 15 - 204
Target Start/End: Complemental strand, 25093837 - 25093648
Alignment:
| Q |
15 |
cacagacatcgaacgcaatacaaacaataatatgtctaataaggataattagagaaattgataaattaaatgtagtcagatgtgtcaatgtcatttcagt |
114 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
25093837 |
cacagacatcgaacgcaatataaacaataatatgtctaataaggataattagagaaattgataaattaaatgtaatcagatgtgtcaatgtcatttcagt |
25093738 |
T |
|
| Q |
115 |
gtcggacatcaaacacatcttcaatacaaagtttagcgataaataaatatttataggtgtaatcaagaggtatagttaccttctttattg |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25093737 |
gtcggacatcaaacacatcttcaatacaaagtttagcgataaataaatatttataggtgtaatcaagaggtatagttaccttctttattg |
25093648 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University