View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19951_high_80 (Length: 206)
Name: NF19951_high_80
Description: NF19951
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19951_high_80 |
 |  |
|
| [»] scaffold0002 (2 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0002 (Bit Score: 116; Significance: 3e-59; HSPs: 2)
Name: scaffold0002
Description:
Target: scaffold0002; HSP #1
Raw Score: 116; E-Value: 3e-59
Query Start/End: Original strand, 10 - 133
Target Start/End: Original strand, 338969 - 339092
Alignment:
| Q |
10 |
tgagatgaaaaattgtatcttaatgtgtatataagttttcaataaggcaactggaataattgcgagtcatgcatattacctgtaacctttatacatattt |
109 |
Q |
| |
|
|||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
338969 |
tgagatcaaaaattgtatcttaatatgtatataagttttcaataaggcaactggaataattgcgagtcatgcatattacctgtaacctttatacatattt |
339068 |
T |
 |
| Q |
110 |
gcctgtaaattttagatcaaagtt |
133 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
339069 |
gcctgtaaattttagatcaaagtt |
339092 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0002; HSP #2
Raw Score: 68; E-Value: 1e-30
Query Start/End: Original strand, 139 - 206
Target Start/End: Original strand, 339372 - 339439
Alignment:
| Q |
139 |
ttatatttgaatgtttgaatttaacatcaaacatacatgtgtccaacataggcttcgggtggttcctc |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
339372 |
ttatatttgaatgtttgaatttaacatcaaacatacatgtgtccaacataggcttcgggtggttcctc |
339439 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University