View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19951_low_22 (Length: 412)
Name: NF19951_low_22
Description: NF19951
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19951_low_22 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 68; Significance: 3e-30; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 68; E-Value: 3e-30
Query Start/End: Original strand, 1 - 92
Target Start/End: Complemental strand, 22550849 - 22550758
Alignment:
| Q |
1 |
tattccatatacgattattaggtataccggtttctattatactgaacaatatctgtacgattccggtattccatatacgattatatatagga |
92 |
Q |
| |
|
|||||||||||||||||| ||||| ||||||||||||||||| |||||||||||||| ||||||||||||| ||||||||||||||||||| |
|
|
| T |
22550849 |
tattccatatacgattataaggtacaccggtttctattataccgaacaatatctgtatgattccggtattctgtatacgattatatatagga |
22550758 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 339 - 412
Target Start/End: Complemental strand, 22550380 - 22550307
Alignment:
| Q |
339 |
gtcagggctggtggtttgcaagacaaagagggaggtatccgtgaactcgtcatagggaaggacgatgagcttct |
412 |
Q |
| |
|
||||| |||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22550380 |
gtcagagctggtggcttgcaagacaaggagggaggtatccgtgaactcgtcatagggaaggacgatgagcttct |
22550307 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University