View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19951_low_36 (Length: 307)
Name: NF19951_low_36
Description: NF19951
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19951_low_36 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 225; Significance: 1e-124; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 19 - 286
Target Start/End: Original strand, 6448953 - 6449222
Alignment:
| Q |
19 |
ttttaaagaatgtacatagtttcatt-gctcttgggacaaaagggaaggagggtaagggattaattaatgatttggcacttagtgatttgagcaatttca |
117 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6448953 |
ttttaaagaatgtacatagtttcatttgctcttgggacaaaagggaaggagagtaagggattaattaatgatttggcacttagtgatttgagcaatttca |
6449052 |
T |
|
| Q |
118 |
aagaatgattgtannnnnnn-ccctttctaatctgtgtccatttgtgtcgaaggtggttgactacattatggtttcgtcttgaaaatggtttatagttag |
216 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6449053 |
aagaatgattgtattttttttccctttctaatctgtgtccatttgtgtcgaaggtggttgactacattatggtttcgtcttgaaaatggtttatagttag |
6449152 |
T |
|
| Q |
217 |
agaaaaatgtgtttcttgtcttattatgaatggtatatgatctcattggattgcatttaaaggaggtagc |
286 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
6449153 |
agaaaaatgtgtttcttgtcttattatgaatggtatatgatatcattggattgcatttaaaggaggtagc |
6449222 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University