View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19951_low_75 (Length: 236)
Name: NF19951_low_75
Description: NF19951
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19951_low_75 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 21 - 214
Target Start/End: Complemental strand, 2264470 - 2264277
Alignment:
| Q |
21 |
agttatctggctgcataaaatcgaaagccatacaaatttccacgtaccatgcatttaagaaaactgtctcctatgaattccaagataagattttgggaac |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2264470 |
agttatctggctgcataaaatcgaaagccatacaaatttccacgtaccatgcatttaagaaaactgtctcctatgaattccaagataagattttgggaac |
2264371 |
T |
|
| Q |
121 |
caatacatgatcccttggccccaaaatccaatagtttccaaaacttctacagtgtctacaatgctaggttgatctatatgactcataataattg |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
2264370 |
caatacatgatcccttggccccaaaatccaatagtttccaaaacttctacagtgtctataatgctaggttgatctatatgactcataataattg |
2264277 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University