View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19952_high_2 (Length: 281)
Name: NF19952_high_2
Description: NF19952
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19952_high_2 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 237; Significance: 1e-131; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 237; E-Value: 1e-131
Query Start/End: Original strand, 17 - 269
Target Start/End: Original strand, 27508186 - 27508438
Alignment:
| Q |
17 |
agaaggaacacttgaagctgttatttgcgcagcttgtaactgtcaccggaacttccaccgcaaagagatcgatggtgaaacggttagttcatgtaaccgg |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27508186 |
agaaggaacacttgaagctgttatttgcgccgcttgtaactgtcaccggaacttccaccgcaaagagatcgatggtgaaacggttagttcatgtaaccgg |
27508285 |
T |
 |
| Q |
117 |
ccacagccaccacctccaccgccgcaataccatcaccacagcaatcaattctcgccttactaccaccgcgctcctccttccacagccggttaccttcacc |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
27508286 |
ccacagccaccacctccaccgccgcaataccatcaccacaacaatcaattctcgccttactaccaccgtgctcctccttccacagccggttaccttcacc |
27508385 |
T |
 |
| Q |
217 |
accatcatcttgcaactccggtggcacatcacagaccgttggctctctctgct |
269 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
27508386 |
accatcatcttgcaactccggtggcacatcacagaccgttggctctccctgct |
27508438 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 58; Significance: 2e-24; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 30 - 95
Target Start/End: Complemental strand, 35192931 - 35192866
Alignment:
| Q |
30 |
gaagctgttatttgcgcagcttgtaactgtcaccggaacttccaccgcaaagagatcgatggtgaa |
95 |
Q |
| |
|
||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
35192931 |
gaagctgttatttgcgccgcttgtaactgtcaccagaacttccaccgcaaagagatcgatggtgaa |
35192866 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 54; Significance: 5e-22; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 30 - 95
Target Start/End: Complemental strand, 44747992 - 44747927
Alignment:
| Q |
30 |
gaagctgttatttgcgcagcttgtaactgtcaccggaacttccaccgcaaagagatcgatggtgaa |
95 |
Q |
| |
|
||||||||||||||||| |||||||||||||||| |||||||||| |||||||||||||||||||| |
|
|
| T |
44747992 |
gaagctgttatttgcgccgcttgtaactgtcaccagaacttccactgcaaagagatcgatggtgaa |
44747927 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 42; Significance: 0.000000000000007; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 18 - 95
Target Start/End: Complemental strand, 46301151 - 46301074
Alignment:
| Q |
18 |
gaaggaacacttgaagctgttatttgcgcagcttgtaactgtcaccggaacttccaccgcaaagagatcgatggtgaa |
95 |
Q |
| |
|
||||||||||| ||||| || ||||| || |||||| ||||||||||||||||||||||||||| ||||| |||||| |
|
|
| T |
46301151 |
gaaggaacactggaagcggtgatttgtgctgcttgtggctgtcaccggaacttccaccgcaaagaaatcgacggtgaa |
46301074 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 17 - 52
Target Start/End: Complemental strand, 1148367 - 1148332
Alignment:
| Q |
17 |
agaaggaacacttgaagctgttatttgcgcagcttg |
52 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||| |
|
|
| T |
1148367 |
agaaggaacacttgaagctgttatttgcgccgcttg |
1148332 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 31; Significance: 0.00000002; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 17 - 51
Target Start/End: Original strand, 30232387 - 30232421
Alignment:
| Q |
17 |
agaaggaacacttgaagctgttatttgcgcagctt |
51 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||| |
|
|
| T |
30232387 |
agaaggaacacttgaagctgttatttgcgccgctt |
30232421 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 19 - 52
Target Start/End: Original strand, 137556 - 137589
Alignment:
| Q |
19 |
aaggaacacttgaagctgttatttgcgcagcttg |
52 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||| |
|
|
| T |
137556 |
aaggaacacttgaagctgttatttgcgccgcttg |
137589 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University