View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19953_high_15 (Length: 311)
Name: NF19953_high_15
Description: NF19953
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19953_high_15 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 157; Significance: 2e-83; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 157; E-Value: 2e-83
Query Start/End: Original strand, 1 - 157
Target Start/End: Original strand, 3018662 - 3018818
Alignment:
| Q |
1 |
aaactaaaccaaacaactaaagaaacaaacccagatatctcaaaactttttcccttgctacaaactaaaagcattaatgatctcaataatactactaatt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3018662 |
aaactaaaccaaacaactaaagaaacaaacccagatatctcaaaactttttcccttgctacaaactaaaagcattaatgatctcaataatactactaatt |
3018761 |
T |
 |
| Q |
101 |
tgtaatattctaccttaaaaatatgcaaactttcaccaaataaaccaattcatctcc |
157 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3018762 |
tgtaatattctaccttaaaaatatgcaaactttcaccaaataaaccaattcatctcc |
3018818 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 257 - 296
Target Start/End: Original strand, 3018916 - 3018955
Alignment:
| Q |
257 |
tgtatttacaaacataccctcactcaatcatgtacctagt |
296 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3018916 |
tgtatttacaaacataccctcactcaatcatgtacctagt |
3018955 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University