View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19953_low_21 (Length: 251)
Name: NF19953_low_21
Description: NF19953
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19953_low_21 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 5 - 244
Target Start/End: Complemental strand, 43100843 - 43100606
Alignment:
| Q |
5 |
atgtcgaagaaaatcaaacaggatgtattataatccacaaacttgtctaaaggacataagcactcttgtatccatgagttcaaaaggcggttccgaatat |
104 |
Q |
| |
|
|||| ||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||| |
|
|
| T |
43100843 |
atgttgaacaaaatcaagcaggatgtattataatccacaaacttgtctaaaggacataagcactcttgtatccgtga----aaaaggcggttccgaatat |
43100748 |
T |
 |
| Q |
105 |
gactcaagttaattagccctctcttgaaatgcaatactgatggtgcatctagag--gataacataacctttccatttgtgttgggatatttaaagatttt |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43100747 |
gactcaagttaattagccctctcttgaaatgcaatactgatggtgcatctagagaggatcacataacctttccatttgtgttgggatatttaaagatttt |
43100648 |
T |
 |
| Q |
203 |
agaggttcgtttattttaaatacgatctggtatggtatatct |
244 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43100647 |
agaggttcgtttattttaaatacgatctggtatggtatatct |
43100606 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University