View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19955_high_20 (Length: 204)
Name: NF19955_high_20
Description: NF19955
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19955_high_20 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 146; Significance: 4e-77; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 146; E-Value: 4e-77
Query Start/End: Original strand, 28 - 188
Target Start/End: Complemental strand, 38765589 - 38765426
Alignment:
| Q |
28 |
aattacttgtagtacaagccacattccccaaaaggtgttggaaagaagcatgaggaagcaacccttgatccatgatgatccagat---agaacatggccc |
124 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
38765589 |
aattacttgcagtacaagccacattccccaaaaggtgttggaaagaagcatgaggaagcaacccttgatccatgatgatccagatagaagaacatggccc |
38765490 |
T |
 |
| Q |
125 |
tgatgttgttgggttttatggtaatttcccaaaaaatgaaaatgggataaaagttccaattgag |
188 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38765489 |
tgatgttgttgggttttatggtaatttcccaaaaaatgaaaatgggataaaagttccaattgag |
38765426 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University