View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19955_low_18 (Length: 233)

Name: NF19955_low_18
Description: NF19955
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19955_low_18
NF19955_low_18
[»] chr5 (1 HSPs)
chr5 (1-221)||(39672013-39672233)


Alignment Details
Target: chr5 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 1 - 221
Target Start/End: Original strand, 39672013 - 39672233
Alignment:
1 tgctttgaaaaggttaaataaatccttggggcaatcagacccataactaattgaaactttgggcgcaatttagagaggatgactgaaaacttgtttgaaa 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||    
39672013 tgctttgaaaaggttaaataaatccttggggcaatcagacccataactaattgaaactttgggcgcaatttagagaggatggctgaaaacttgtttgaaa 39672112  T
101 aatattgtggatttcaagtcatatagcttcctgagagggtggaggccctatcctcttcccccctgttgaaccttcaactaaatctctttttgctcatttg 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
39672113 aatattgtggatttcaagtcatatagcttcctgagagggtggaggccctatcctcttcccccctgttgaaccttcaactaaatctctttttgctcatttg 39672212  T
201 aattgttatttcagttggtga 221  Q
    |||||||||||||||||||||    
39672213 aattgttatttcagttggtga 39672233  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University