View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19955_low_19 (Length: 227)
Name: NF19955_low_19
Description: NF19955
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19955_low_19 |
 | |
|
| [»] scaffold0856 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0856 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: scaffold0856
Description:
Target: scaffold0856; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 1 - 211
Target Start/End: Original strand, 4033 - 4243
Alignment:
| Q |
1 |
acctgcaaacgattttctgtcgtatatattggttgcccaatcttcatctgaaaatcctgagatgtccaagtctgatgatagctttatgggaagacaatag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4033 |
acctgcaaacgattttctgtcgtatatattggttgcccaatcttcatctgaaaatcctgagatgtccaagtctgatgatagctttatgggaagacaatag |
4132 |
T |
|
| Q |
101 |
tccaagctggaccttttctctaataagatggaaatttataaagacatgcttggatctttcatgaaatgtgggattgtgagctaagtagatggaggcgggt |
200 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4133 |
tccaagctggaccttttctataataagatggaaatttataaagacatgcttggatctttcatgaaatgtgggattgtgagctaagtagatggaggcgggt |
4232 |
T |
|
| Q |
201 |
ttgtcaaaagt |
211 |
Q |
| |
|
||||||||||| |
|
|
| T |
4233 |
ttgtcaaaagt |
4243 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University