View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19955_low_8 (Length: 337)
Name: NF19955_low_8
Description: NF19955
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19955_low_8 |
 | |
|
| [»] chr7 (2 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 307; Significance: 1e-173; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 307; E-Value: 1e-173
Query Start/End: Original strand, 19 - 337
Target Start/End: Complemental strand, 43099754 - 43099436
Alignment:
| Q |
19 |
gatcggctattttgttctcaaaccccgtatccctgagttcagtgtcaattcagcttcacttacctcattcaatttgaccggctccggtctcaatgcaaaa |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43099754 |
gatcggctattttgttctcaaaccccgtatccctgagttcagtgtcaattcagcttcacttacctcattcaatttgaccggctccggtctcaatgcaaaa |
43099655 |
T |
|
| Q |
119 |
tgggacatcacactcattgtctcaaaccctaacaaaaaactcgatatcacatacgacgccgttgctgccagtgtcttttacggagatgatgaatatggtg |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
43099654 |
tgggacatcacactcattgtctcaaaccctaacaaaaaactcgatatcacatacgacgccgttgctgccagtgtcttttacggtgatgatgaatatggtg |
43099555 |
T |
|
| Q |
219 |
ttctagcatacactcgtctcgcaccttttcaccaaccaacacatagcaagaccatgttacgagtacaattcgaagttctcgattattttgtggataacag |
318 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43099554 |
ttctagcatacactcgtctcgcaccttttcaccaaccaacacatagcaagaccatgttacgagtacaattcgaagttctcgattattttgtggataacag |
43099455 |
T |
|
| Q |
319 |
ggtatcttttggtattact |
337 |
Q |
| |
|
|||||||| ||||||||| |
|
|
| T |
43099454 |
tgtatctttcggtattact |
43099436 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 107 - 201
Target Start/End: Complemental strand, 43106880 - 43106786
Alignment:
| Q |
107 |
ctcaatgcaaaatgggacatcacactcattgtctcaaaccctaacaaaaaactcgatatcacatacgacgccgttgctgccagtgtcttttacgg |
201 |
Q |
| |
|
|||| ||||||||||||||||||| |||||| |||||||||||||||||||||||| ||||| ||| |||||||| ||| ||||||||||||| |
|
|
| T |
43106880 |
ctcactgcaaaatgggacatcacattcattgcctcaaaccctaacaaaaaactcgacatcacctacaacgccgtttctgttggtgtcttttacgg |
43106786 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University