View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19956_low_15 (Length: 212)

Name: NF19956_low_15
Description: NF19956
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19956_low_15
NF19956_low_15
[»] chr6 (1 HSPs)
chr6 (16-196)||(5607918-5608098)


Alignment Details
Target: chr6 (Bit Score: 161; Significance: 5e-86; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 161; E-Value: 5e-86
Query Start/End: Original strand, 16 - 196
Target Start/End: Complemental strand, 5608098 - 5607918
Alignment:
16 aatatattcttaatagaattatgaacaagtttgtacgaaatgttagcggttgaaggggagtcgcaaccaatccattcgcagatggagctacaaataaata 115  Q
    |||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
5608098 aatatattctcaatagaattgtgaacaagtttgtacgaaatgttagcggttgaaggggagtcgcaaccaatccattcgcagatggagctacaaataaata 5607999  T
116 tgaaaatagaagtaaaaatattgtgtgctttcacttttttacttttaatttgtatcatttcaattttagcatctctagagt 196  Q
    ||| ||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
5607998 tgataattgaagtaaaattattgtgtgctttcacttttttacttttaatttgtatcatttcaattttagcatctctagagt 5607918  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University