View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19956_low_15 (Length: 212)
Name: NF19956_low_15
Description: NF19956
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19956_low_15 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 161; Significance: 5e-86; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 161; E-Value: 5e-86
Query Start/End: Original strand, 16 - 196
Target Start/End: Complemental strand, 5608098 - 5607918
Alignment:
| Q |
16 |
aatatattcttaatagaattatgaacaagtttgtacgaaatgttagcggttgaaggggagtcgcaaccaatccattcgcagatggagctacaaataaata |
115 |
Q |
| |
|
|||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5608098 |
aatatattctcaatagaattgtgaacaagtttgtacgaaatgttagcggttgaaggggagtcgcaaccaatccattcgcagatggagctacaaataaata |
5607999 |
T |
 |
| Q |
116 |
tgaaaatagaagtaaaaatattgtgtgctttcacttttttacttttaatttgtatcatttcaattttagcatctctagagt |
196 |
Q |
| |
|
||| ||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5607998 |
tgataattgaagtaaaattattgtgtgctttcacttttttacttttaatttgtatcatttcaattttagcatctctagagt |
5607918 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University