View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19956_low_8 (Length: 320)
Name: NF19956_low_8
Description: NF19956
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19956_low_8 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 235; Significance: 1e-130; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 10 - 305
Target Start/End: Complemental strand, 15973730 - 15973433
Alignment:
| Q |
10 |
attattctctcatttgttagcaaattgcaaagcaaaatcccatcccaatatatatatgtagaggcatatgtataacggtataaatacgttgcttaaagaa |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||| ||||||||||||||||||||||||||| ||||| |
|
|
| T |
15973730 |
attattctctcatttgttagcaaattgcaaagcaaaatcccatcccaatatatataagtagatgcaaatgtataacggtataaatacgttgcttgaagaa |
15973631 |
T |
 |
| Q |
110 |
tnnnnnnnn--gggaataacaaaatttaccataaaagaaaagaacaacaaaacccttacggcaaagacacgtttatgaataatttggtactcacaaccca |
207 |
Q |
| |
|
| | |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15973630 |
taaaaagaaaagtgaataacaaaatttaccataaaagaaaacaacaacaaaacccttacggcaaagacacgtttatgaataatttggtactcacaaccca |
15973531 |
T |
 |
| Q |
208 |
ttcaaccagatgtatctataatatttctttatggtaattagatgtatccatattaccgacatcatttactcgtcatgtatgaattatatacatattat |
305 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15973530 |
ttcaaccagatgtatctataatatttctttatggtaattagatgtatcgatattaccgacatcatttactcgtcatgtatgaattatatacatattat |
15973433 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University