View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19957_low_17 (Length: 264)
Name: NF19957_low_17
Description: NF19957
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19957_low_17 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 250; Significance: 1e-139; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 250; E-Value: 1e-139
Query Start/End: Original strand, 1 - 262
Target Start/End: Original strand, 713700 - 713961
Alignment:
| Q |
1 |
cataagagagttatgtgttcaacattattcaggggtcgtttgattttaatatgttcgataatatggaagtgtcgtattggggtttgaggaagaaacataa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
713700 |
cataagagagttatgtgttcaacattattcaggggtcgtttggttttaatatgttcgataatatggaagtgtcgtattggggtttgaggaagaaacataa |
713799 |
T |
 |
| Q |
101 |
gagagttatgtgttcaactttccctctaataagaataataatcaattgtccatacgcctatcttaatcagtaaaaattgtaaaattgtcagattgaacgt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
713800 |
gagagttatgtgttcaactttccctctaataagaataataatcaactgtccatacgcctatcttaatcagtaaaaattgtaaaattgtcagattgaacgt |
713899 |
T |
 |
| Q |
201 |
cgtgatcagagattagaactctgattcctttctttagcagtgctgatatattcttcgacatc |
262 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
713900 |
cgtgatcagagattagaactctgattcctttctttagcagtgctgatatatgcttcgacatc |
713961 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 76 - 118
Target Start/End: Original strand, 713680 - 713722
Alignment:
| Q |
76 |
attggggtttgaggaagaaacataagagagttatgtgttcaac |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
713680 |
attggggtttgaggaagaaacataagagagttatgtgttcaac |
713722 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University