View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19957_low_18 (Length: 233)
Name: NF19957_low_18
Description: NF19957
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19957_low_18 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 1 - 215
Target Start/End: Complemental strand, 23205296 - 23205080
Alignment:
| Q |
1 |
cattcattgaaatcaaacggagtgaagacagcacattatgacaaataagttcagtacgtat--gtattcaactgcacatagactcttacctagctagctc |
98 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23205296 |
cattcattgaaatcaaacggagtgaagacagcacattatgacaaataagttcaatacgtatatgtattcaactgcacatagactcttacctagctagctc |
23205197 |
T |
 |
| Q |
99 |
cggtgggaattaatgcaaaatgaaagacaccattgcaccacgatatgaggtttttctttgccaacctttatctgattgcattaaaatagcctttattatc |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23205196 |
cggtgggaattaatgcaaaatgaaagacaccattgcaccacgatatgaggtttttctttgccaacctttatctgattgcattaaaatagcctttattatc |
23205097 |
T |
 |
| Q |
199 |
tcattcatttttaaaat |
215 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
23205096 |
tcattcatttttaaaat |
23205080 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University