View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19958_low_10 (Length: 371)
Name: NF19958_low_10
Description: NF19958
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19958_low_10 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 277; Significance: 1e-155; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 277; E-Value: 1e-155
Query Start/End: Original strand, 1 - 349
Target Start/End: Complemental strand, 46072380 - 46072049
Alignment:
| Q |
1 |
caactttaggtattttaaaccgtgttcgaatcagctggggtatatcaactctcagcctctatactgaagtgggagatatattttctgttaagctgccata |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
46072380 |
caactttaggtattttaaaccgtgttcgaatcagctggggtatatcaactctcagcctctata-----------------ttttctgttaagctgccata |
46072298 |
T |
|
| Q |
101 |
tttttcattgtaaataaagatgaaaaatttgtatagattcctttattttgtagatgtgttctgccagttttctttatcaaaaggaatatcattcaatatt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46072297 |
tttttcattgtaaataaagatgaaaaatttgtatagattcctttattttgtagatgtgttctgccagttttctttatcaaaaggaatatcattcaatatt |
46072198 |
T |
|
| Q |
201 |
tgcatataatttaattaagtttatacactgctatgaatagttcttcaaatctctcggggtatccactgtgcgtgtggatactaatgttggtgcttttcta |
300 |
Q |
| |
|
|||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||| |
|
|
| T |
46072197 |
tgcatataatttaattaattttacacactgctatgaatagttcttcaaatctctcggggtatccactatgcgtgtgggtactaatgttggtgcttttcta |
46072098 |
T |
|
| Q |
301 |
taggtcaaattttagcttacaatcgttggttaaattgaaaaggacacgc |
349 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46072097 |
taggtcaaattttagcttacaatcgttggttaaattgaaaaggacacgc |
46072049 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University