View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19959_high_3 (Length: 354)
Name: NF19959_high_3
Description: NF19959
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19959_high_3 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 324; Significance: 0; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 324; E-Value: 0
Query Start/End: Original strand, 1 - 336
Target Start/End: Original strand, 48864212 - 48864547
Alignment:
| Q |
1 |
aattattcccttgtatcccaagtgaatcagcttactttttaccagtcatacctgcaaccacctgcaacgatatagaacaccaatatcaggaaaccataaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48864212 |
aattattcccttgtatcccaagtgaatcagcttactttttaccagtcatacctgcaaccacctgcaacgatatagaacaccaatatcaggaaaccataaa |
48864311 |
T |
|
| Q |
101 |
tctaaatgatggtctcaatctggcgagagtagggactagaaagtgcatctcaaacccctttctagacaagctattcttgcaactaatggttggattacat |
200 |
Q |
| |
|
| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48864312 |
tgtaaatgatggtctcaatctggcgatagtagggactagaaagtgcatctcaaacccctttctagacaagctattcttgcaactaatggttggattacat |
48864411 |
T |
|
| Q |
201 |
cgattgtatttatgattgtgagcacttgaaaatattgggtgctttgtttcaagtgatactaatgggaaaaacagaatgtaggggatgatttgcaaaatca |
300 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
48864412 |
cgattgtatttatgattgtgagcacttgaaaatattgggtgctttgtttcaagtgatactaatgggaaaaacaaaatgtaggggatgatttgcaaaatca |
48864511 |
T |
|
| Q |
301 |
agcagcatatactataatgctgaaactctgctggtt |
336 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
48864512 |
agcagcatatactataatgctgaaactctgctggtt |
48864547 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University