View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19959_low_6 (Length: 284)
Name: NF19959_low_6
Description: NF19959
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19959_low_6 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 38 - 273
Target Start/End: Original strand, 33717483 - 33717718
Alignment:
| Q |
38 |
aattgaacaaatgcatgataatccaaaaacttcttattacgatcagcgtcagccagaaggggatcccctcacatagaacaggttttcggatcatagtaag |
137 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33717483 |
aattgaacaaatgcatgataatccaaaaacttcttattaggatcagcgtcggccagaaggggatcccctcacatagaacaggttttcggatcatagtaag |
33717582 |
T |
|
| Q |
138 |
cagaattgacttcaagcttcaaaaggtattttaccatgtcctctcagatacacaagtttctgaagcaaacgaatagaataatcacaaacaggaagacaaa |
237 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
33717583 |
cagaattgacatcaagcttcaaaaggtattttaccatgtcctctcagatacacaagtttatgaagcaaacaaatagaataatcacaaacaggaagacaaa |
33717682 |
T |
|
| Q |
238 |
tataattagtaaagaaatgaaccttacagtttctgt |
273 |
Q |
| |
|
|||||||||||||||||| |||||||||||| |||| |
|
|
| T |
33717683 |
tataattagtaaagaaataaaccttacagttcctgt |
33717718 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University