View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1995_low_2 (Length: 236)
Name: NF1995_low_2
Description: NF1995
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1995_low_2 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 162; Significance: 1e-86; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 11 - 199
Target Start/End: Complemental strand, 43029338 - 43029149
Alignment:
| Q |
11 |
ttactaatatagaaaaattacaattaaaattaaatgtgcgaccttttttaccttaaaaataattacgatgaaagtcaaatgtcttgaaatatccgacagt |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||| ||||||||||| |
|
|
| T |
43029338 |
ttactaatatagaaaaattacaattaaaattaaatgtgcgaccttttttactttaaaaataattacgatgaaagtcaaatgttttgaattatccgacagt |
43029239 |
T |
 |
| Q |
111 |
aatgattaattggcaatgtaccaaaacaaaattacactcactgagcatatgaattaaatttatatc-aataccttttaggaagagaaact |
199 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||| |
|
|
| T |
43029238 |
aatgattaattggcaatgtaccaaatcaaaattacactcactgagcatatgaattaaatttatatcaaataccttttaagaagagaaact |
43029149 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University