View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19961_low_13 (Length: 324)
Name: NF19961_low_13
Description: NF19961
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19961_low_13 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 125; Significance: 2e-64; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 125; E-Value: 2e-64
Query Start/End: Original strand, 182 - 310
Target Start/End: Complemental strand, 21259994 - 21259866
Alignment:
| Q |
182 |
aaatcaaatgcatagtctgcaccattacgtcaatttccttgatttcgttgctcatctttttgatcgttgctctctcgccacccttcaatgtcaagttcga |
281 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21259994 |
aaatcaaatgcatagcctgcaccattacgtcaatttccttgatttcgttgctcatctttttgatcgttgctctctcgccacccttcaatgtcaagttcga |
21259895 |
T |
 |
| Q |
282 |
cataacaaatatctccctcatgcaattca |
310 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
21259894 |
cataacaaatatctccctcatgcaattca |
21259866 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 97 - 186
Target Start/End: Complemental strand, 21264854 - 21264765
Alignment:
| Q |
97 |
acaaatttctactctctataaatacacataagctaagcacgctttgttcgacaaatcacattcaccatgagtacaagagatagtcaaatc |
186 |
Q |
| |
|
|||||| | |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
21264854 |
acaaatctttactctctataaatacacataagctaagcatgctttgttcgacaaatcacattcaccatgagtacaagagggagtcaaatc |
21264765 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 51 - 80
Target Start/End: Complemental strand, 21264886 - 21264857
Alignment:
| Q |
51 |
aaagaaggatctacaatatatttatttatt |
80 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
21264886 |
aaagaaggatctacaatatatttatttatt |
21264857 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University