View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19961_low_18 (Length: 281)
Name: NF19961_low_18
Description: NF19961
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19961_low_18 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 13 - 266
Target Start/End: Original strand, 3543561 - 3543812
Alignment:
| Q |
13 |
aatattgatatcttgacttgtggttaacattaannnnnnnnacttatcctatatgtataaagtatagactatgaatttctttatcaagggtttaattggt |
112 |
Q |
| |
|
||||||||||||||||||||||||| |||| || ||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||| |
|
|
| T |
3543561 |
aatattgatatcttgacttgtggttgacatgaattttttt-acttatcctatatgtataaagtatagactgtgaatttctttatca-gggtttaattggt |
3543658 |
T |
 |
| Q |
113 |
aaatttaggtgtgtgttaaatgagtaatatttttctgattgatttgggcaaattaatttttattttgtgaaattaaagctttatataaggaggaggttca |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3543659 |
aaatttaggtgtgtgttaaatgagtaatatttttctgattgatttgggcaaattaatttttattttgtgaaattaaagctttatataaggaggaggttca |
3543758 |
T |
 |
| Q |
213 |
actcaattttctaaacctctagagtattgttgacaccataatgtgatcattttt |
266 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3543759 |
actcaattttctaaacctctagagtattgttgacaccataatgtgatcattttt |
3543812 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University