View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19962_low_3 (Length: 283)
Name: NF19962_low_3
Description: NF19962
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19962_low_3 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 230; Significance: 1e-127; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 18 - 259
Target Start/End: Complemental strand, 40975790 - 40975550
Alignment:
| Q |
18 |
gttttcagcttcaataatttgaattgccaaagagagaggaacaatcacaacatattgtgatcgatcgtttgacagtagtatgcgcaccaacaacaatcac |
117 |
Q |
| |
|
|||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40975790 |
gttttctgcttcaataatttgaat-gccaaagagagaggaacaatcacaacatattgtgatcgatcgtttgacagtagtatgcgcaccaacaacaatcac |
40975692 |
T |
|
| Q |
118 |
aatctctctctcatatatagtactgaataaagaccgaagaacaaataatacactgaatcttgttatttttcctctattttaatagatttttaacttatca |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40975691 |
aatctctctctcatatatagtactgaataaagaccgaagaacaaataatacactgaatcttgttatttttcctctattttaatagatttttaacttatca |
40975592 |
T |
|
| Q |
218 |
acaaagtaatacgaaccatttggactatagaacatacactta |
259 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40975591 |
acaaagtaatacgaaccatttggactatagaacatacactta |
40975550 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University