View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19964_high_25 (Length: 280)
Name: NF19964_high_25
Description: NF19964
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19964_high_25 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 16 - 274
Target Start/End: Original strand, 48287474 - 48287732
Alignment:
| Q |
16 |
caaatgacttgctattctaacttaagttgttgattgatttgtttatgattgattacaggatcaaaatatgatgagttggggatgtgttattatacaaatc |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48287474 |
caaatgacttgctattctaacttaagttgttgatggatttgtttatgattgattacaggatcaaaatatgatgagttggggatgtgttattatacaaatc |
48287573 |
T |
|
| Q |
116 |
tggatatggatttggcagattgatcgatgttcattgcgcaattcagaaatgaaggttttgtgatcatattggatatctaaattannnnnnngttacttct |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
48287574 |
tggatatggatttggcagattgatcgatgttcattgcgcaattcagaaatgaaggttttgtgatcatattggatatctaaattatttttttgttacttct |
48287673 |
T |
|
| Q |
216 |
tttttctgtgttaagagatgaaggaagaataaaatgaagaaacatgttatattcttgga |
274 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||| | |||||| |
|
|
| T |
48287674 |
tttttctctgttaagagatgaaggaagaataaaatgaagaaacatgttatttgcttgga |
48287732 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University