View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19964_low_31 (Length: 250)

Name: NF19964_low_31
Description: NF19964
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19964_low_31
NF19964_low_31
[»] chr1 (1 HSPs)
chr1 (12-225)||(1757485-1757697)


Alignment Details
Target: chr1 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 12 - 225
Target Start/End: Original strand, 1757485 - 1757697
Alignment:
12 attatacttgatgcgcaaaatcaagttgaacagattgtcatattgtgtctcaacgattttcatatttaaattatagttgataataaatgtgtatatcttt 111  Q
    |||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||     
1757485 attataattgatgagcaaaatcaagttgaacagattgtcatattgtgtctcaacgattttcatatttaaattatagttgataataaatgtgtatatcttg 1757584  T
112 attcagatttaatctatcaggataatcatatttgtcggaatgttcaaatcaagttggacactatgttttctaatccagcctcaaataacgctgaggaaat 211  Q
     |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||    
1757585 -ttcagatttaatctatcaggataatcatatttgtcggaatgttcaaatcaagttggacactatgttttctaatccaccctcaaataacgctgaggaaat 1757683  T
212 tgttgccatggtga 225  Q
    ||||||||||||||    
1757684 tgttgccatggtga 1757697  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University