View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19964_low_31 (Length: 250)
Name: NF19964_low_31
Description: NF19964
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19964_low_31 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 12 - 225
Target Start/End: Original strand, 1757485 - 1757697
Alignment:
| Q |
12 |
attatacttgatgcgcaaaatcaagttgaacagattgtcatattgtgtctcaacgattttcatatttaaattatagttgataataaatgtgtatatcttt |
111 |
Q |
| |
|
|||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1757485 |
attataattgatgagcaaaatcaagttgaacagattgtcatattgtgtctcaacgattttcatatttaaattatagttgataataaatgtgtatatcttg |
1757584 |
T |
 |
| Q |
112 |
attcagatttaatctatcaggataatcatatttgtcggaatgttcaaatcaagttggacactatgttttctaatccagcctcaaataacgctgaggaaat |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
1757585 |
-ttcagatttaatctatcaggataatcatatttgtcggaatgttcaaatcaagttggacactatgttttctaatccaccctcaaataacgctgaggaaat |
1757683 |
T |
 |
| Q |
212 |
tgttgccatggtga |
225 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
1757684 |
tgttgccatggtga |
1757697 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University