View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19964_low_34 (Length: 233)
Name: NF19964_low_34
Description: NF19964
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19964_low_34 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 123; Significance: 2e-63; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 123; E-Value: 2e-63
Query Start/End: Original strand, 12 - 180
Target Start/End: Original strand, 16870488 - 16870649
Alignment:
| Q |
12 |
atattgaacaatgtgtgcagataatatcttatcagcatggaagaagcaattctgggacccccgtcaaagctcttactctggatggagttatattgactcg |
111 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
16870488 |
atattgaacaatgtgtgcagataatatcatatcagcatggaagaagcaattctgggacccctgtcaaagctcttactctggatggagttattttgactcg |
16870587 |
T |
 |
| Q |
112 |
atggttgaagacgaggatgaataacgctgttgtcttcattcttcattcttacgtgttgtcgcaccggta |
180 |
Q |
| |
|
|||||| ||||||||||| ||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
16870588 |
atggttaaagacgaggataaataacgctgttgtctt-------cattcttacgtgttgtcgcaccggta |
16870649 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 55; E-Value: 9e-23
Query Start/End: Original strand, 12 - 70
Target Start/End: Complemental strand, 16655645 - 16655587
Alignment:
| Q |
12 |
atattgaacaatgtgtgcagataatatcttatcagcatggaagaagcaattctgggacc |
70 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
16655645 |
atattgaacaatgtgtgcagataatatcttatcagcatggaagaagcaattttgggacc |
16655587 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 12 - 64
Target Start/End: Original strand, 16558660 - 16558712
Alignment:
| Q |
12 |
atattgaacaatgtgtgcagataatatcttatcagcatggaagaagcaattct |
64 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
16558660 |
atattgaacaatgtgtgcagataatatcatatcagcatggaagaagcaattct |
16558712 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University