View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19964_low_39 (Length: 227)

Name: NF19964_low_39
Description: NF19964
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19964_low_39
NF19964_low_39
[»] chr8 (1 HSPs)
chr8 (1-131)||(16750927-16751057)


Alignment Details
Target: chr8 (Bit Score: 119; Significance: 6e-61; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 119; E-Value: 6e-61
Query Start/End: Original strand, 1 - 131
Target Start/End: Complemental strand, 16751057 - 16750927
Alignment:
1 gtttagtacaataacatgaaattgttcttaaacatgtagttgtatctcttatcttgttggtcaggaaatttcgctcgcaaacaacatgttggtcgcattt 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||    
16751057 gtttagtacaataacatgaaattgttcttaaacatgtagttgtatctcttatcttgttggtcaggaaatttagctcgcaaacaacttgttggtcgcattt 16750958  T
101 tgtagtagttgaaatcggtattcttatttat 131  Q
    |||||||||||||||||||||||||| ||||    
16750957 tgtagtagttgaaatcggtattcttagttat 16750927  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University