View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19965_high_11 (Length: 430)

Name: NF19965_high_11
Description: NF19965
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19965_high_11
NF19965_high_11
[»] chr3 (1 HSPs)
chr3 (352-419)||(21742760-21742827)


Alignment Details
Target: chr3 (Bit Score: 41; Significance: 0.00000000000004; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 352 - 419
Target Start/End: Original strand, 21742760 - 21742827
Alignment:
352 atttaggtat-ctatcatagagggaagattgtacatcaaaactgttttaatattttaaaacaccttcat 419  Q
    |||||||||| |||| | |||||||||||||||||||||||||| |||||||| |||||||||||||||    
21742760 atttaggtatgctattagagagggaagattgtacatcaaaactg-tttaatatcttaaaacaccttcat 21742827  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University