View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19965_high_11 (Length: 430)
Name: NF19965_high_11
Description: NF19965
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19965_high_11 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 41; Significance: 0.00000000000004; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 352 - 419
Target Start/End: Original strand, 21742760 - 21742827
Alignment:
| Q |
352 |
atttaggtat-ctatcatagagggaagattgtacatcaaaactgttttaatattttaaaacaccttcat |
419 |
Q |
| |
|
|||||||||| |||| | |||||||||||||||||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
21742760 |
atttaggtatgctattagagagggaagattgtacatcaaaactg-tttaatatcttaaaacaccttcat |
21742827 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University