View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19965_high_23 (Length: 318)
Name: NF19965_high_23
Description: NF19965
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19965_high_23 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 295; Significance: 1e-166; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 295; E-Value: 1e-166
Query Start/End: Original strand, 16 - 318
Target Start/End: Complemental strand, 47126964 - 47126662
Alignment:
| Q |
16 |
atgaagacaagaatcgatctcatacaatcttgcaccattatcatatgggtggcttctgcttttcatgcagctgtgaactttggacaatacccttatgcag |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47126964 |
atgaagacaagaatcgatctcatacaatcttgcaccattattatatgggtggcttctgcttttcatgcagctgtgaactttggacaatacccttatgcag |
47126865 |
T |
 |
| Q |
116 |
gttacctaccaaatcgtccaacggttagtcgtaggtttatgcctgagcaaggtacaccagagtatgaagagcttgagtcagatcctgaattagcattctt |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47126864 |
gttacctaccaaatcgtccaacggttagtcgtaggtttatgcctgagcaaggtacaccagagtatgaagagcttgagtcagatcctgaattagcattctt |
47126765 |
T |
 |
| Q |
216 |
aaaaacaatcacagctcagttccaaactcttcttggtgtgtcattgatagaagttctgtctaggcattcgactgaagaggtttatcttgggcagacagta |
315 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
47126764 |
aaaaacaatcacagctcagttccaaactcttcttggtgtgtcattgatagaagttctgtctaggcattcgactgaagaggtttatcttggacagacagta |
47126665 |
T |
 |
| Q |
316 |
gac |
318 |
Q |
| |
|
||| |
|
|
| T |
47126664 |
gac |
47126662 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 38; Significance: 0.000000000002; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 50 - 119
Target Start/End: Original strand, 9606270 - 9606339
Alignment:
| Q |
50 |
ccattatcatatgggtggcttctgcttttcatgcagctgtgaactttggacaatacccttatgcaggtta |
119 |
Q |
| |
|
|||||||||||||| ||||||||| ||||||||||||| || ||||||||||| ||||||| |||||| |
|
|
| T |
9606270 |
ccattatcatatggactgcttctgctcttcatgcagctgttaattttggacaatatccttatggaggtta |
9606339 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 36; Significance: 0.00000000003; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 58 - 137
Target Start/End: Complemental strand, 46709234 - 46709155
Alignment:
| Q |
58 |
atatgggtggcttctgcttttcatgcagctgtgaactttggacaatacccttatgcaggttacctaccaaatcgtccaac |
137 |
Q |
| |
|
|||||| | ||||| ||| | ||||||||||| |||||||||||||| |||| |||||||||| |||||| |||||||| |
|
|
| T |
46709234 |
atatggattgcttcagctctacatgcagctgtaaactttggacaatatccttttgcaggttactcaccaaaccgtccaac |
46709155 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 33; Significance: 0.000000002; HSPs: 4)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 40 - 112
Target Start/End: Complemental strand, 6456223 - 6456151
Alignment:
| Q |
40 |
caatcttgcaccattatcatatgggtggcttctgcttttcatgcagctgtgaactttggacaatacccttatg |
112 |
Q |
| |
|
||||||||| |||||||||||||| ||||| ||| |||||||||| || ||||||||||| || ||||||| |
|
|
| T |
6456223 |
caatcttgctccattatcatatggactgcttcagctcttcatgcagcagttaactttggacagtatccttatg |
6456151 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 40 - 110
Target Start/End: Complemental strand, 6449756 - 6449686
Alignment:
| Q |
40 |
caatcttgcaccattatcatatgggtggcttctgcttttcatgcagctgtgaactttggacaataccctta |
110 |
Q |
| |
|
||||||||| ||||||| |||||| ||||||||| ||||||||||||| || || |||||||| ||||| |
|
|
| T |
6449756 |
caatcttgctccattattatatggactgcttctgctcttcatgcagctgttaatttcggacaatatcctta |
6449686 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 44 - 104
Target Start/End: Complemental strand, 7458044 - 7457984
Alignment:
| Q |
44 |
cttgcaccattatcatatgggtggcttctgcttttcatgcagctgtgaactttggacaata |
104 |
Q |
| |
|
||||||||||| |||||||| | ||||| || ||||||||||||| || ||||||||||| |
|
|
| T |
7458044 |
cttgcaccattctcatatggattgcttcagcacttcatgcagctgttaattttggacaata |
7457984 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 44 - 104
Target Start/End: Complemental strand, 7470446 - 7470386
Alignment:
| Q |
44 |
cttgcaccattatcatatgggtggcttctgcttttcatgcagctgtgaactttggacaata |
104 |
Q |
| |
|
||||||||||| |||||||| | ||||| || ||||||||||||| || ||||||||||| |
|
|
| T |
7470446 |
cttgcaccattctcatatggattgcttcagcacttcatgcagctgttaattttggacaata |
7470386 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University