View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19965_high_28 (Length: 278)

Name: NF19965_high_28
Description: NF19965
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19965_high_28
NF19965_high_28
[»] chr8 (1 HSPs)
chr8 (100-192)||(11963201-11963293)


Alignment Details
Target: chr8 (Bit Score: 81; Significance: 3e-38; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 81; E-Value: 3e-38
Query Start/End: Original strand, 100 - 192
Target Start/End: Complemental strand, 11963293 - 11963201
Alignment:
100 agtctctaccattaatttgactctcaattttgatgatgtgacaattaattgaacaacgtggcattggtagtatgcttaagttgtagccatgtc 192  Q
    |||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||    
11963293 agtctctaccattaatttgactttcaattttgatgatgtgacaattaattgaacgacgtggcattggtagtatgtttaagttgtagccatgtc 11963201  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University