View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19965_high_30 (Length: 265)
Name: NF19965_high_30
Description: NF19965
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19965_high_30 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 149; Significance: 9e-79; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 149; E-Value: 9e-79
Query Start/End: Original strand, 19 - 218
Target Start/End: Complemental strand, 21852253 - 21852057
Alignment:
| Q |
19 |
ggtcccttacaaacagatggaacaatatgaagacaacgctgaagcagatgaattgcatggttactcacatatacagggttaannnnnnnnnnccttcaaa |
118 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||| |||||||| |
|
|
| T |
21852253 |
ggtcctttacaaacagatggaacaatatgaagacaacgctgaagtagatgaattgcatggttactcacatatacagagttaattttttt---ccttcaaa |
21852157 |
T |
 |
| Q |
119 |
taagtgcatatttgaacaagtgcttatttaagctcttgagtcaaattttatgcactctaatagtgttcttttcagaatactttatttaaataattgtttc |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21852156 |
taagtgcatatttgaacaagtgcttatttaagcttttgagtcaaattttatgcactctaatagtgttcttttcagaatactttatttaaataattgtttc |
21852057 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University