View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19965_high_32 (Length: 250)
Name: NF19965_high_32
Description: NF19965
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19965_high_32 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 122; Significance: 1e-62; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 1 - 126
Target Start/End: Complemental strand, 36675200 - 36675075
Alignment:
| Q |
1 |
aattgacaatttctcaaaacaacattgaatgaaaatgagagctgaagagtttaggctgttgttttgttgcatagatataataatagtcctttttgttttc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36675200 |
aattgacaatttctcaaaacaacattgaatgaaaatgagagctgaagtgtttaggctgttgttttgttgcatagatataataatagtcctttttgttttc |
36675101 |
T |
 |
| Q |
101 |
ttttatttggctgtcatggtttaatg |
126 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
36675100 |
ttttatttggctgtcatggtttaatg |
36675075 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 158 - 241
Target Start/End: Complemental strand, 36675043 - 36674960
Alignment:
| Q |
158 |
ttctcacttagattggtcttgactcttgatacatatatgtcttggtaacatttgaaacacaagtggttagtttggtagaattat |
241 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
36675043 |
ttctcacttagattggtcttgactcttgatacatatatgtcttggtaacatctgaaacacaagtggttagtttggtagaattat |
36674960 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 1 - 83
Target Start/End: Complemental strand, 36669524 - 36669442
Alignment:
| Q |
1 |
aattgacaatttctcaaaacaacattgaatgaaaatgagagctgaagagtttaggctgttgttttgttgcatagatataataa |
83 |
Q |
| |
|
||||||||||| ||||||| ||||||||||||||| |||||||||||| ||| |||||||||||||||||||||||||||||| |
|
|
| T |
36669524 |
aattgacaattcctcaaaagaacattgaatgaaaacgagagctgaagatttttggctgttgttttgttgcatagatataataa |
36669442 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University