View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19968_low_6 (Length: 253)
Name: NF19968_low_6
Description: NF19968
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19968_low_6 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 162; Significance: 1e-86; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 63 - 236
Target Start/End: Original strand, 51527131 - 51527304
Alignment:
| Q |
63 |
cgatcgacatattcatgtattagagagatttgatcttaataacattgatgagattgagcatttggcaaaatttaatctgttgaaggagattgtttattaa |
162 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51527131 |
cgatcgacatattcatgtactagagagatttgatcttaataacattgatgagattgagcatttggcaaaatttaatctgttgaaggagattgtttattaa |
51527230 |
T |
 |
| Q |
163 |
ttaggcgtggacggcatggtggcatatcatagccatcatttttattgggtatccttattgtatgtgtaagctag |
236 |
Q |
| |
|
|||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51527231 |
ttaggcgtggacggcatggtggcaaatcatagtcatcatttttattgggtatccttattgtatgtgtaagctag |
51527304 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University