View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19969_low_13 (Length: 326)
Name: NF19969_low_13
Description: NF19969
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19969_low_13 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 46 - 316
Target Start/End: Complemental strand, 32364120 - 32363857
Alignment:
| Q |
46 |
agtgttaattctcataaacatatgagctaccgatccttgcttctacttaaatcacttttgatccctaaaattacgttcaacaattgctatccaaacatct |
145 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
32364120 |
agtgttaattctcataaacatatgagctaccgatccttgcttctacttaaatcacttttgat-------attacgttcaacaattgctatccaaacatct |
32364028 |
T |
|
| Q |
146 |
aataaattgttttgaagtttcatgttgtttgcctaagtaacaagtgtcgagcactctaactcatacaatatttttcattcattttgatttcttaagttac |
245 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32364027 |
aataaattgttttgaagtttcatgttgtttgcctaagtaacaagtgtcgagcactctaactcatacaatatttttcattcattttgatttcttaagttac |
32363928 |
T |
|
| Q |
246 |
aaactttaaatatccaacatttgtaacnnnnnnnngcaagttgccacagccggaatgatttccatattctt |
316 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||| ||||| |
|
|
| T |
32363927 |
aaactttaaatatccaacatttgtaacttttttttgcaagttgccacagccgaaatgatttccattttctt |
32363857 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University