View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19970_high_2 (Length: 556)
Name: NF19970_high_2
Description: NF19970
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19970_high_2 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 523; Significance: 0; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 523; E-Value: 0
Query Start/End: Original strand, 22 - 544
Target Start/End: Complemental strand, 43547099 - 43546577
Alignment:
| Q |
22 |
tagggttggatgcaaagcctctttatctgtcaaaatgcacgattcttctgccaagtggatcgtatccggcttcgtcagagaacacaatcacgaacttgtt |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43547099 |
tagggttggatgcaaagcctctttatctgtcaaaatgcacgattcttctgccaagtggatcgtatccggcttcgtcagagaacacaatcacgaacttgtt |
43547000 |
T |
 |
| Q |
122 |
ccacccgatcaggttcactgccttcgttcccacaggcaaatttctggttctgcaaaaaccctaattgacactctacaggctgctggtatgggtcctcgcc |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43546999 |
ccacccgatcaggttcactgccttcgttcccacaggcaaatttctggttctgcaaaaaccctaattgacactctacaggctgctggtatgggtcctcgcc |
43546900 |
T |
 |
| Q |
222 |
gaattatgtctgcactcatcaaagagtatggtggtatcagcaaagttggctttactgaggttgattgtaggaattacatgaggaataatcgccataaaag |
321 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43546899 |
gaattatgtctgcactcatcaaagagtatggtggtatcagcaaagttggctttactgaggttgattgtaggaattacatgaggaataatcgccataaaag |
43546800 |
T |
 |
| Q |
322 |
tttacaaggcgacattcaacttgttcttgattatttgagacaaatgcatgcccaaaatcctaatttcttctttgctgttcaaggtgatcttgatgacgag |
421 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43546799 |
tttacaaggcgacattcaacttgttcttgattatttgagacaaatgcatgcccaaaatcctaatttcttctttgctgttcaaggtgatcttgatgacgag |
43546700 |
T |
 |
| Q |
422 |
gatcatcccatcaccaatgttttctgggctgaccccaaggcaaggttgaattacacttttttcggagatactgtcacttttgacactacttaccgctcta |
521 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43546699 |
gatcatcccatcaccaatgttttctgggctgaccccaaggcaaggttgaattacacttttttcggagatactgtcacttttgacactacttaccgctcta |
43546600 |
T |
 |
| Q |
522 |
acaggtatcgattaccctttgct |
544 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
43546599 |
acaggtatcgattaccctttgct |
43546577 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University