View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19970_low_4 (Length: 423)
Name: NF19970_low_4
Description: NF19970
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19970_low_4 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 164; Significance: 2e-87; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 164; E-Value: 2e-87
Query Start/End: Original strand, 44 - 239
Target Start/End: Original strand, 11625971 - 11626165
Alignment:
| Q |
44 |
caataaacacagcgaattgatactcgcagtacatgtttagtatcacagtggattcgttgcagtctatgattttgacaaagtcaccgtgatatcaaacatg |
143 |
Q |
| |
|
||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||| ||||||||||| ||||||| ||||||||||||||||||| |
|
|
| T |
11625971 |
caataaacacagcgaattgatactcacggtacatgtttagtatcacagtggattcgttgccgtctatgattt-gacaaagccaccgtgatatcaaacatg |
11626069 |
T |
 |
| Q |
144 |
cacgatacagaaaacaaaaatgtctccttaatcatataaaaatcttaagtatccataattgcgccagatagcatactttaatttatcaaaaaagtt |
239 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||| |
|
|
| T |
11626070 |
cacgatacagaaaacaaaaatgtctccttaatcatataaaaatcttaagtatccataattgcgcgagataacatactttaatttatcaaaaaagtt |
11626165 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 92; E-Value: 1e-44
Query Start/End: Original strand, 303 - 410
Target Start/End: Original strand, 11626229 - 11626336
Alignment:
| Q |
303 |
catccatagccgccgcgggcgaaacattttcctcaccagcaatcataagagcttcactctccccaggaaaaagaatcttcttcccaaaaagcttaatttc |
402 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
11626229 |
catccatagccgccgcgggcgaaacattttcctcaccatcaatcataagagcttcaccttccccaggaaaaagaatcttcttcccaaagagcttaatttc |
11626328 |
T |
 |
| Q |
403 |
agggtcct |
410 |
Q |
| |
|
|||||||| |
|
|
| T |
11626329 |
agggtcct |
11626336 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University