View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19970_low_5 (Length: 404)

Name: NF19970_low_5
Description: NF19970
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19970_low_5
NF19970_low_5
[»] chr5 (40 HSPs)
chr5 (193-399)||(22298314-22298525)
chr5 (65-165)||(25328017-25328117)
chr5 (58-165)||(36568545-36568650)
chr5 (58-154)||(27502023-27502119)
chr5 (58-154)||(6500525-6500621)
chr5 (58-147)||(32487468-32487557)
chr5 (65-165)||(42405574-42405672)
chr5 (67-165)||(1028493-1028591)
chr5 (66-151)||(15370182-15370267)
chr5 (56-153)||(26074134-26074231)
chr5 (62-154)||(6500901-6500993)
chr5 (58-142)||(40296314-40296398)
chr5 (58-153)||(9498643-9498737)
chr5 (62-133)||(36492225-36492296)
chr5 (58-142)||(3295344-3295427)
chr5 (20-88)||(22298927-22298995)
chr5 (62-118)||(29549278-29549334)
chr5 (58-165)||(624271-624378)
chr5 (58-133)||(18603128-18603203)
chr5 (58-153)||(26074687-26074782)
chr5 (62-133)||(33747850-33747921)
chr5 (58-133)||(34753033-34753108)
chr5 (58-125)||(41170709-41170776)
chr5 (61-118)||(301029-301086)
chr5 (58-99)||(13042614-13042655)
chr5 (66-165)||(623901-623998)
chr5 (58-154)||(3295002-3295098)
chr5 (66-153)||(6224279-6224366)
chr5 (58-165)||(15370477-15370583)
chr5 (69-151)||(26900007-26900089)
chr5 (67-119)||(795254-795306)
chr5 (58-142)||(11416976-11417060)
chr5 (61-133)||(35150084-35150156)
chr5 (61-153)||(38427625-38427717)
chr5 (58-97)||(13112612-13112651)
chr5 (58-125)||(13415776-13415843)
chr5 (58-120)||(24489227-24489289)
chr5 (58-152)||(41632857-41632950)
chr5 (65-148)||(26590902-26590986)
chr5 (82-150)||(38427318-38427386)
[»] chr2 (31 HSPs)
chr2 (58-150)||(36178596-36178688)
chr2 (58-151)||(5542615-5542708)
chr2 (58-154)||(6421806-6421902)
chr2 (62-153)||(6421464-6421555)
chr2 (58-133)||(6422185-6422260)
chr2 (62-152)||(37106003-37106093)
chr2 (58-151)||(14745657-14745750)
chr2 (58-151)||(15511486-15511578)
chr2 (58-154)||(23346311-23346407)
chr2 (58-149)||(15880338-15880429)
chr2 (58-153)||(36178159-36178254)
chr2 (58-153)||(42514724-42514819)
chr2 (58-151)||(962673-962766)
chr2 (58-130)||(33731723-33731795)
chr2 (62-154)||(41283462-41283554)
chr2 (69-151)||(40163362-40163444)
chr2 (58-142)||(35580723-35580807)
chr2 (58-133)||(3672776-3672851)
chr2 (58-133)||(5543006-5543081)
chr2 (62-133)||(36005888-36005959)
chr2 (58-133)||(37106263-37106338)
chr2 (81-151)||(1769990-1770060)
chr2 (62-165)||(3673147-3673249)
chr2 (62-165)||(16590962-16591065)
chr2 (58-97)||(29874067-29874106)
chr2 (58-101)||(37895101-37895144)
chr2 (58-140)||(29676983-29677065)
chr2 (62-131)||(12529038-12529107)
chr2 (58-99)||(14745336-14745377)
chr2 (62-99)||(28254279-28254316)
chr2 (58-114)||(36784287-36784343)
[»] chr6 (32 HSPs)
chr6 (61-147)||(1846826-1846912)
chr6 (58-153)||(16454650-16454745)
chr6 (58-154)||(2578430-2578526)
chr6 (58-154)||(16454982-16455078)
chr6 (58-152)||(3415533-3415629)
chr6 (62-154)||(2578822-2578914)
chr6 (58-154)||(29518578-29518674)
chr6 (58-154)||(29518995-29519091)
chr6 (58-154)||(32741254-32741350)
chr6 (58-165)||(2377829-2377935)
chr6 (58-147)||(2378201-2378290)
chr6 (62-154)||(2843634-2843726)
chr6 (58-165)||(16107753-16107861)
chr6 (58-153)||(1127435-1127530)
chr6 (62-135)||(2579498-2579571)
chr6 (62-131)||(3409338-3409407)
chr6 (65-133)||(6999804-6999872)
chr6 (61-133)||(35210282-35210354)
chr6 (58-133)||(3058301-3058376)
chr6 (58-125)||(10074007-10074074)
chr6 (62-152)||(10074352-10074442)
chr6 (66-154)||(2579860-2579947)
chr6 (58-142)||(3409735-3409819)
chr6 (69-154)||(2579097-2579181)
chr6 (62-151)||(14748332-14748417)
chr6 (67-154)||(12071678-12071765)
chr6 (66-165)||(26544132-26544230)
chr6 (87-133)||(3409405-3409451)
chr6 (61-95)||(21130103-21130137)
chr6 (58-99)||(11637763-11637804)
chr6 (61-125)||(12085050-12085114)
chr6 (82-165)||(16108150-16108233)
[»] chr7 (35 HSPs)
chr7 (62-154)||(22567026-22567118)
chr7 (61-153)||(37533352-37533444)
chr7 (58-152)||(30244345-30244439)
chr7 (58-154)||(1085603-1085699)
chr7 (61-165)||(11845269-11845372)
chr7 (62-153)||(30245156-30245243)
chr7 (62-153)||(30253571-30253658)
chr7 (58-150)||(23368-23460)
chr7 (58-165)||(7517655-7517762)
chr7 (61-135)||(36939739-36939813)
chr7 (64-154)||(47129450-47129539)
chr7 (66-151)||(30032650-30032735)
chr7 (58-151)||(34218024-34218117)
chr7 (61-162)||(37167859-37167960)
chr7 (58-118)||(45754790-45754850)
chr7 (61-120)||(19122809-19122868)
chr7 (58-153)||(45433316-45433411)
chr7 (62-148)||(6054639-6054725)
chr7 (62-150)||(37533002-37533089)
chr7 (66-140)||(28300569-28300644)
chr7 (58-145)||(40094770-40094857)
chr7 (58-120)||(8128462-8128524)
chr7 (58-116)||(24177510-24177568)
chr7 (58-99)||(16569271-16569312)
chr7 (58-99)||(16596350-16596391)
chr7 (61-105)||(29157643-29157687)
chr7 (62-125)||(9901722-9901785)
chr7 (58-112)||(7554100-7554154)
chr7 (71-153)||(37532739-37532821)
chr7 (58-99)||(14681585-14681626)
chr7 (58-99)||(21416183-21416224)
chr7 (58-99)||(23569044-23569085)
chr7 (58-118)||(24838724-24838784)
chr7 (58-118)||(28300276-28300336)
chr7 (84-152)||(30245256-30245324)
[»] chr3 (36 HSPs)
chr3 (58-142)||(3135453-3135537)
chr3 (62-165)||(37990615-37990718)
chr3 (58-134)||(22303962-22304038)
chr3 (62-133)||(15772933-15773004)
chr3 (58-153)||(29644890-29644985)
chr3 (66-133)||(37990985-37991052)
chr3 (58-167)||(41359465-41359574)
chr3 (62-154)||(43346777-43346870)
chr3 (61-165)||(42342364-42342468)
chr3 (58-153)||(29644569-29644664)
chr3 (58-137)||(39934959-39935038)
chr3 (58-131)||(32462910-32462983)
chr3 (58-142)||(32589778-32589862)
chr3 (62-150)||(42342081-42342169)
chr3 (62-154)||(15773271-15773365)
chr3 (62-133)||(22304648-22304719)
chr3 (58-117)||(54017572-54017631)
chr3 (58-132)||(41359774-41359848)
chr3 (63-149)||(53577444-53577530)
chr3 (66-132)||(54018207-54018273)
chr3 (58-157)||(1634299-1634397)
chr3 (58-165)||(52634750-52634856)
chr3 (66-165)||(54017793-54017891)
chr3 (62-120)||(4823734-4823792)
chr3 (58-120)||(12114583-12114645)
chr3 (58-120)||(12749244-12749306)
chr3 (59-125)||(31190085-31190151)
chr3 (58-167)||(35946597-35946706)
chr3 (58-104)||(39389145-39389191)
chr3 (58-130)||(22303670-22303742)
chr3 (82-165)||(49336662-49336746)
chr3 (66-133)||(45901797-45901864)
chr3 (68-142)||(50612446-50612520)
chr3 (62-99)||(39336012-39336049)
chr3 (65-130)||(39914334-39914399)
chr3 (58-142)||(33803251-33803335)
[»] chr8 (42 HSPs)
chr8 (62-153)||(3669766-3669857)
chr8 (62-140)||(34834955-34835033)
chr8 (58-165)||(3038265-3038373)
chr8 (62-141)||(6731974-6732053)
chr8 (58-165)||(9483163-9483270)
chr8 (65-142)||(8919143-8919220)
chr8 (58-151)||(40518146-40518239)
chr8 (55-152)||(40579258-40579355)
chr8 (58-133)||(30441160-30441235)
chr8 (62-151)||(6651573-6651662)
chr8 (58-165)||(30359346-30359454)
chr8 (62-133)||(5915946-5916017)
chr8 (58-120)||(20870594-20870656)
chr8 (62-151)||(6876852-6876941)
chr8 (58-162)||(9482583-9482687)
chr8 (63-139)||(40579508-40579584)
chr8 (58-133)||(3670135-3670210)
chr8 (58-131)||(147895-147968)
chr8 (67-151)||(1014234-1014319)
chr8 (58-131)||(32640542-32640615)
chr8 (61-154)||(41129066-41129159)
chr8 (58-150)||(40518657-40518749)
chr8 (58-129)||(70286-70357)
chr8 (62-165)||(9309434-9309535)
chr8 (62-129)||(33113379-33113446)
chr8 (58-135)||(1013877-1013954)
chr8 (62-154)||(18371980-18372073)
chr8 (62-151)||(34835288-34835377)
chr8 (62-151)||(34835554-34835643)
chr8 (62-151)||(34835820-34835909)
chr8 (69-154)||(37544478-37544562)
chr8 (85-150)||(43274626-43274691)
chr8 (68-132)||(12283957-12284021)
chr8 (62-142)||(45122703-45122783)
chr8 (58-133)||(9507857-9507932)
chr8 (58-121)||(9609160-9609223)
chr8 (58-133)||(30359684-30359759)
chr8 (62-153)||(45121898-45121989)
chr8 (68-131)||(45122067-45122130)
chr8 (108-165)||(3037944-3038002)
chr8 (58-151)||(9309054-9309149)
chr8 (58-142)||(32305552-32305636)
[»] chr4 (48 HSPs)
chr4 (60-147)||(54343000-54343087)
chr4 (58-151)||(54017583-54017676)
chr4 (62-154)||(39792845-39792937)
chr4 (58-133)||(25483411-25483486)
chr4 (62-164)||(36629316-36629418)
chr4 (69-154)||(39404104-39404189)
chr4 (58-133)||(1731653-1731728)
chr4 (58-141)||(49302981-49303064)
chr4 (58-165)||(54936271-54936376)
chr4 (62-132)||(54108616-54108686)
chr4 (58-163)||(50630731-50630836)
chr4 (62-165)||(22028342-22028446)
chr4 (62-142)||(23817678-23817758)
chr4 (62-154)||(43827519-43827610)
chr4 (58-165)||(3340882-3340988)
chr4 (66-153)||(10246002-10246089)
chr4 (58-165)||(41370432-41370538)
chr4 (67-154)||(44620743-44620830)
chr4 (58-147)||(18932741-18932830)
chr4 (61-130)||(50788003-50788072)
chr4 (61-153)||(36608647-36608739)
chr4 (58-133)||(44620428-44620503)
chr4 (58-151)||(18879881-18879974)
chr4 (58-131)||(50459796-50459869)
chr4 (58-142)||(22183261-22183345)
chr4 (61-165)||(50002504-50002608)
chr4 (58-150)||(55933113-55933205)
chr4 (62-133)||(32941129-32941200)
chr4 (69-140)||(45489331-45489402)
chr4 (63-117)||(22027983-22028037)
chr4 (58-131)||(52884770-52884844)
chr4 (58-120)||(54108988-54109049)
chr4 (66-154)||(2740783-2740869)
chr4 (66-131)||(39404481-39404546)
chr4 (58-150)||(49076820-49076912)
chr4 (66-133)||(20825919-20825986)
chr4 (62-133)||(44621081-44621152)
chr4 (61-144)||(48111693-48111776)
chr4 (58-120)||(4955336-4955398)
chr4 (63-125)||(19504776-19504838)
chr4 (62-120)||(34646668-34646726)
chr4 (62-112)||(45496884-45496934)
chr4 (58-120)||(49880235-49880296)
chr4 (58-99)||(10396491-10396532)
chr4 (58-99)||(11197301-11197342)
chr4 (67-120)||(40067128-40067181)
chr4 (82-151)||(43174240-43174309)
chr4 (62-151)||(31691231-31691322)
[»] scaffold0391 (2 HSPs)
scaffold0391 (58-165)||(1083-1189)
scaffold0391 (58-99)||(1733-1774)
[»] chr1 (38 HSPs)
chr1 (58-165)||(45493951-45494057)
chr1 (58-151)||(41142447-41142541)
chr1 (61-133)||(41759561-41759633)
chr1 (58-165)||(44290800-44290908)
chr1 (58-153)||(26661886-26661981)
chr1 (62-165)||(40082485-40082588)
chr1 (58-165)||(44290435-44290541)
chr1 (66-130)||(5319976-5320040)
chr1 (58-153)||(17294652-17294748)
chr1 (58-165)||(34364582-34364688)
chr1 (58-132)||(37556186-37556260)
chr1 (62-120)||(39066221-39066279)
chr1 (62-132)||(41157070-41157140)
chr1 (63-144)||(14318947-14319028)
chr1 (58-154)||(3875318-3875414)
chr1 (58-133)||(3537607-3537682)
chr1 (58-125)||(29798274-29798341)
chr1 (58-133)||(32168706-32168781)
chr1 (66-132)||(37555812-37555878)
chr1 (58-132)||(41157450-41157524)
chr1 (58-135)||(34365000-34365077)
chr1 (68-153)||(50052012-50052096)
chr1 (65-149)||(11977026-11977110)
chr1 (81-165)||(21378036-21378119)
chr1 (62-118)||(26661545-26661601)
chr1 (62-133)||(48588496-48588567)
chr1 (58-153)||(50051677-50051771)
chr1 (65-143)||(34649520-34649598)
chr1 (58-131)||(9955984-9956057)
chr1 (65-154)||(31767148-31767237)
chr1 (68-152)||(5528743-5528827)
chr1 (58-105)||(3550795-3550842)
chr1 (65-144)||(11977362-11977441)
chr1 (58-125)||(38804371-38804438)
chr1 (65-99)||(12466365-12466399)
chr1 (68-142)||(45084461-45084535)
chr1 (19-60)||(37556121-37556162)
chr1 (58-111)||(44043802-44043855)
[»] scaffold0702 (2 HSPs)
scaffold0702 (58-165)||(491-597)
scaffold0702 (82-147)||(141-206)
[»] scaffold0078 (2 HSPs)
scaffold0078 (62-133)||(5061-5132)
scaffold0078 (58-99)||(5432-5473)
[»] scaffold0027 (1 HSPs)
scaffold0027 (58-142)||(47435-47519)


Alignment Details
Target: chr5 (Bit Score: 180; Significance: 4e-97; HSPs: 40)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 180; E-Value: 4e-97
Query Start/End: Original strand, 193 - 399
Target Start/End: Complemental strand, 22298525 - 22298314
Alignment:
193 ggtgagatcatccatacagtaacttcataaggcatggaatctatgaaacaccttttcaccctaacatttatcttggtggtatagtacatagagagctgga 292  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||    
22298525 ggtgagatcatccatacagtaacttcataaggcatggaatctatgaaacaccttttcaccctaacaattatcttggtggtatagtacagagagagctgga 22298426  T
293 gtgtgtgttagagaaagaggtgtagcag-----cataacacaaggagtggcagtggtactgctagtgtcgtatattggtgttgtgttctatgcttgcatt 387  Q
    ||||||||||||||||||||||||||||     |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||    
22298425 gtgtgtgttagagaaagaggtgtagcagcatagcataacacaaggagtggcagtggtactgctagtgtcgtatattggtgttgtgttctatgcatgcatt 22298326  T
388 gcttcatctctc 399  Q
    ||||||||||||    
22298325 gcttcatctctc 22298314  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 61; E-Value: 4e-26
Query Start/End: Original strand, 65 - 165
Target Start/End: Original strand, 25328017 - 25328117
Alignment:
65 tgccttaaggtttttgataagagtgtggtgtctcttttgcttatgtggttgttctatcctcaatgtggatgatcccccgagctcccctcagtgtcccaac 164  Q
    |||||||||||||| | |||||||||||||||||| ||||   ||||||||||||| |||||||||||| | ||||||||||||||||||||| ||||||    
25328017 tgccttaaggttttgggtaagagtgtggtgtctctcttgcaagtgtggttgttctagcctcaatgtggacggtcccccgagctcccctcagtgacccaac 25328116  T
165 a 165  Q
    |    
25328117 a 25328117  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 61; E-Value: 4e-26
Query Start/End: Original strand, 58 - 165
Target Start/End: Complemental strand, 36568650 - 36568545
Alignment:
58 aacccattgccttaaggtttttgataagagtgtggtgtctcttttgcttatgtggttgttctatcctcaatgtggatgatcccccgagctcccctcagtg 157  Q
    ||||||||||||||||||||||| ||||||||||| |||||| |  ||| |||||||||||||||||| ||||||| | |||||||||||||||||| ||    
36568650 aacccattgccttaaggtttttggtaagagtgtggcgtctctct--cttgtgtggttgttctatcctcgatgtggaaggtcccccgagctcccctcaatg 36568553  T
158 tcccaaca 165  Q
     |||||||    
36568552 acccaaca 36568545  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #4
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 58 - 154
Target Start/End: Complemental strand, 27502119 - 27502023
Alignment:
58 aacccattgccttaaggtttttgataagagtgtggtgtctcttttgcttatgtggttgttctatcctcaatgtggatgatcccccgagctcccctca 154  Q
    |||| ||||||||||| |||||| ||| |||||||||||||| |||||| |||||||||||||||||| ||||||| | |||||| |||||||||||    
27502119 aacctattgccttaagatttttggtaaaagtgtggtgtctctcttgcttgtgtggttgttctatcctcgatgtggacggtccccctagctcccctca 27502023  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #5
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 58 - 154
Target Start/End: Original strand, 6500525 - 6500621
Alignment:
58 aacccattgccttaaggtttttgataagagtgtggtgtctcttttgcttatgtggttgttctatcctcaatgtggatgatcccccgagctcccctca 154  Q
    ||||||||||||||||||||| | |||||||||||||||||| |||||| || |||||||||| |||| ||||||| | ||||||  ||||||||||    
6500525 aacccattgccttaaggttttgggtaagagtgtggtgtctctcttgcttgtgcggttgttctagcctcgatgtggacggtcccccaggctcccctca 6500621  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #6
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 58 - 147
Target Start/End: Original strand, 32487468 - 32487557
Alignment:
58 aacccattgccttaaggtttttgataagagtgtggtgtctcttttgcttatgtggttgttctatcctcaatgtggatgatcccccgagct 147  Q
    ||||||||||||||||||||| | ||||||||||  || ||| |||||||||||||||||||| |||| ||||||||| |||||| ||||    
32487468 aacccattgccttaaggttttgggtaagagtgtgacgtatctcttgcttatgtggttgttctagcctcgatgtggatggtcccccaagct 32487557  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #7
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 65 - 165
Target Start/End: Complemental strand, 42405672 - 42405574
Alignment:
65 tgccttaaggtttttgataagagtgtggtgtctcttttgcttatgtggttgttctatcctcaatgtggatgatcccccgagctcccctcagtgtcccaac 164  Q
    |||||||||||||| | |||||||||||||||||||  |||| || |||||||||| |||| ||||||| | ||||||||||||||| ||||| ||||||    
42405672 tgccttaaggttttgggtaagagtgtggtgtctctt--gcttgtgcggttgttctagcctcgatgtggacggtcccccgagctccccccagtgacccaac 42405575  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #8
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 67 - 165
Target Start/End: Complemental strand, 1028591 - 1028493
Alignment:
67 ccttaaggtttttgataagagtgtggtgtctcttttgcttatgtggttgttctatcctcaatgtggatgatcccccgagctcccctcagtgtcccaaca 165  Q
    |||||||||||||| ||||||||||| |||||| |  ||| || |||||||||| |||| ||||||| | |||||| |||||||||||||| |||||||    
1028591 ccttaaggtttttggtaagagtgtggcgtctctctcacttgtgcggttgttctagcctcgatgtggacggtccccctagctcccctcagtgacccaaca 1028493  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #9
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 66 - 151
Target Start/End: Original strand, 15370182 - 15370267
Alignment:
66 gccttaaggtttttgataagagtgtggtgtctcttttgcttatgtggttgttctatcctcaatgtggatgatcccccgagctcccc 151  Q
    ||||||||||||| | |||||||||||||||||| |||||| || | |||||||| |||| ||||||| | |||||||||||||||    
15370182 gccttaaggttttgggtaagagtgtggtgtctctcttgcttgtgggattgttctagcctcgatgtggacggtcccccgagctcccc 15370267  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #10
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 56 - 153
Target Start/End: Complemental strand, 26074231 - 26074134
Alignment:
56 tgaacccattgccttaaggtttttgataagagtgtggtgtctcttttgcttatgtggttgttctatcctcaatgtggatgatcccccgagctcccctc 153  Q
    ||||||||||||||||||||||| | |||||||||||||||||| |  ||  |||||||| |||| |||| |||||| ||||||||  ||||||||||    
26074231 tgaacccattgccttaaggttttgggtaagagtgtggtgtctctctcactagtgtggttgctctaacctcgatgtgggtgatccccaaagctcccctc 26074134  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #11
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 62 - 154
Target Start/End: Original strand, 6500901 - 6500993
Alignment:
62 cattgccttaaggtttttgataagagtgtggtgtctcttttgcttatgtggttgttctatcctcaatgtggatgatcccccgagctcccctca 154  Q
    ||||||||||||||||| |||||||||||||||||||| || ||| || |||| ||||| |||| ||||||| | ||||||  ||||||||||    
6500901 cattgccttaaggttttggataagagtgtggtgtctctcttacttgtgcggttattctagcctcgatgtggacggtcccccaggctcccctca 6500993  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #12
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 58 - 142
Target Start/End: Complemental strand, 40296398 - 40296314
Alignment:
58 aacccattgccttaaggtttttgataagagtgtggtgtctcttttgcttatgtggttgttctatcctcaatgtggatgatccccc 142  Q
    ||||||||||||| ||||||| | |||||||||||||||||| |||||| || |||||||||| |||| ||||||| | ||||||    
40296398 aacccattgccttgaggttttgggtaagagtgtggtgtctctcttgcttgtgcggttgttctagcctcgatgtggacggtccccc 40296314  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #13
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 58 - 153
Target Start/End: Complemental strand, 9498737 - 9498643
Alignment:
58 aacccattgccttaaggtttttgataagagtgtggtgtctcttttgcttatgtggttgttctatcctcaatgtggatgatcccccgagctcccctc 153  Q
    |||||||||||||||| |||| | |||||||||||||||||| ||| |||||| | || |||| |||||||||||| | |||||| ||||||||||    
9498737 aacccattgccttaagattttgggtaagagtgtggtgtctctcttgtttatgt-gctggtctagcctcaatgtggacggtccccctagctcccctc 9498643  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #14
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 62 - 133
Target Start/End: Complemental strand, 36492296 - 36492225
Alignment:
62 cattgccttaaggtttttgataagagtgtggtgtctcttttgcttatgtggttgttctatcctcaatgtgga 133  Q
    |||| |||| ||||||| |||||||||||||||||||| |||||| ||||||||||||| |||| |||||||    
36492296 cattacctttaggttttggataagagtgtggtgtctctcttgcttgtgtggttgttctagcctcgatgtgga 36492225  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #15
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 58 - 142
Target Start/End: Complemental strand, 3295427 - 3295344
Alignment:
58 aacccattgccttaaggtttttgataagagtgtggtgtctcttttgcttatgtggttgttctatcctcaatgtggatgatccccc 142  Q
    |||| |||||||||||||||| | |||||||||| ||||||| |||||| ||||||||||||| |||| ||||||| | ||||||    
3295427 aaccaattgccttaaggttttgg-taagagtgtgttgtctctcttgcttgtgtggttgttctagcctcgatgtggacggtccccc 3295344  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #16
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 20 - 88
Target Start/End: Complemental strand, 22298995 - 22298927
Alignment:
20 gttatatgtctcacatcgcttaaaaatagtaaaggttgaacccattgccttaaggtttttgataagagt 88  Q
    |||||||||||||||||   |||||||| ||||||||||| |||||||||||||||||| | |||||||    
22298995 gttatatgtctcacatcagataaaaataataaaggttgaatccattgccttaaggttttgggtaagagt 22298927  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #17
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 62 - 118
Target Start/End: Complemental strand, 29549334 - 29549278
Alignment:
62 cattgccttaaggtttttgataagagtgtggtgtctcttttgcttatgtggttgttc 118  Q
    |||| |||||||||||| ||||||||||||| |||||| ||||||||||||||||||    
29549334 cattaccttaaggttttggataagagtgtggcgtctctcttgcttatgtggttgttc 29549278  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #18
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 58 - 165
Target Start/End: Original strand, 624271 - 624378
Alignment:
58 aacccattgccttaaggtttttgataagagtgtggtgtctcttttgcttatgtggttgttctatcctcaatgtggatgatcccccgagctcccctcagtg 157  Q
    ||||||| ||||| ||||||| | |||||||||||||||||| |  ||| || |||||||||| |||| ||||||| | | |||||||||||||  ||||    
624271 aacccatagccttgaggttttgggtaagagtgtggtgtctctctcacttgtggggttgttctagcctcgatgtggacggttccccgagctccccctagtg 624370  T
158 tcccaaca 165  Q
     |||||||    
624371 acccaaca 624378  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #19
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 58 - 133
Target Start/End: Complemental strand, 18603203 - 18603128
Alignment:
58 aacccattgccttaaggtttttgataagagtgtggtgtctcttttgcttatgtggttgttctatcctcaatgtgga 133  Q
    ||||||||||||||||||||| | |||||||||||  ||||| |||||| |||||| |||||| |||| |||||||    
18603203 aacccattgccttaaggttttgggtaagagtgtggcatctctcttgcttgtgtggtagttctagcctcgatgtgga 18603128  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #20
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 58 - 153
Target Start/End: Original strand, 26074687 - 26074782
Alignment:
58 aacccattgccttaaggtttttgataagagtgtggtgtctcttttgcttatgtggttgttctatcctcaatgtggatgatcccccgagctcccctc 153  Q
    ||||||||||||||||||||| | |||||||||||||||||| |  ||  |||||||| |||| |||| |||||| |||||||   ||||||||||    
26074687 aacccattgccttaaggttttgggtaagagtgtggtgtctctctcactagtgtggttgctctaacctcgatgtgggtgatccctaaagctcccctc 26074782  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #21
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 62 - 133
Target Start/End: Original strand, 33747850 - 33747921
Alignment:
62 cattgccttaaggtttttgataagagtgtggtgtctcttttgcttatgtggttgttctatcctcaatgtgga 133  Q
    |||||||||||| |||| |||||||||||||||||||| || |||||| |||||||||| |||  |||||||    
33747850 cattgccttaagattttggataagagtgtggtgtctctcttccttatgcggttgttctagccttgatgtgga 33747921  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #22
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 58 - 133
Target Start/End: Complemental strand, 34753108 - 34753033
Alignment:
58 aacccattgccttaaggtttttgataagagtgtggtgtctcttttgcttatgtggttgttctatcctcaatgtgga 133  Q
    |||| |||||||||||||||| | ||||||||||| |||||| |||||| || |||||||||| |||| |||||||    
34753108 aaccgattgccttaaggttttgggtaagagtgtggcgtctctcttgcttgtgcggttgttctagcctcgatgtgga 34753033  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #23
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 58 - 125
Target Start/End: Original strand, 41170709 - 41170776
Alignment:
58 aacccattgccttaaggtttttgataagagtgtggtgtctcttttgcttatgtggttgttctatcctc 125  Q
    ||||||||||||||||||||| | |||||||||||||| | | |||||| ||||||||||||| ||||    
41170709 aacccattgccttaaggttttgggtaagagtgtggtgtttttcttgcttgtgtggttgttctagcctc 41170776  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #24
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 61 - 118
Target Start/End: Original strand, 301029 - 301086
Alignment:
61 ccattgccttaaggtttttgataagagtgtggtgtctcttttgcttatgtggttgttc 118  Q
    ||||||||||||| |||||| |||||||||||||||||| |||||| ||||| |||||    
301029 ccattgccttaagatttttggtaagagtgtggtgtctctcttgcttgtgtggctgttc 301086  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #25
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 58 - 99
Target Start/End: Original strand, 13042614 - 13042655
Alignment:
58 aacccattgccttaaggtttttgataagagtgtggtgtctct 99  Q
    ||||||||||||||||||||| ||||||||||||||||||||    
13042614 aacccattgccttaaggttttggataagagtgtggtgtctct 13042655  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #26
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 66 - 165
Target Start/End: Original strand, 623901 - 623998
Alignment:
66 gccttaaggtttttgataagagtgtggtgtctcttttgcttatgtggttgttctatcctcaatgtggatgatcccccgagctcccctcagtgtcccaaca 165  Q
    |||||||||||||   |||||||||||||||||| |  ||| || |||||||||| ||||||||| || | |||||||||||  |||||||| |||||||    
623901 gccttaaggttttgagtaagagtgtggtgtctctctcacttgtggggttgttctagcctcaatgtagacggtcccccgagct--cctcagtgacccaaca 623998  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #27
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 58 - 154
Target Start/End: Complemental strand, 3295098 - 3295002
Alignment:
58 aacccattgccttaaggtttttgataagagtgtggtgtctcttttgcttatgtggttgttctatcctcaatgtggatgatcccccgagctcccctca 154  Q
    ||||||||||||| ||||||| | || ||||||||||||||| ||| || |||||||||| || |||| |||||||   ||||||  ||||||||||    
3295098 aacccattgccttgaggttttgggtatgagtgtggtgtctctcttggttgtgtggttgttgtagcctcgatgtggacagtccccctcgctcccctca 3295002  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #28
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 66 - 153
Target Start/End: Original strand, 6224279 - 6224366
Alignment:
66 gccttaaggtttttgataagagtgtggtgtctcttttgcttatgtggttgttctatcctcaatgtggatgatcccccgagctcccctc 153  Q
    ||||||||||||||| ||||||||||||| |||  |||||| || ||||| |||| ||||||| |||| | ||||||  |||||||||    
6224279 gccttaaggtttttggtaagagtgtggtgcctcagttgcttgtgcggttggtctagcctcaatatggacggtcccccaggctcccctc 6224366  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #29
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 58 - 165
Target Start/End: Original strand, 15370477 - 15370583
Alignment:
58 aacccattgccttaaggtttttgataagagtgtggtgtctcttttgcttatgtggttgttctatcctcaatgtggatgatcccccgagctcccctcagtg 157  Q
    ||||||| |||||||||||||   ||||||||||| |||||| ||| || || |||||||||| |||| ||||||| | ||| ||  |||||||||| ||    
15370477 aacccatagccttaaggttttgcgtaagagtgtggcgtctctcttgtttgtggggttgttctagcctcgatgtggacggtcctccatgctcccctca-tg 15370575  T
158 tcccaaca 165  Q
    ||||||||    
15370576 tcccaaca 15370583  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #30
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 69 - 151
Target Start/End: Complemental strand, 26900089 - 26900007
Alignment:
69 ttaaggtttttgataagagtgtggtgtctcttttgcttatgtggttgttctatcctcaatgtggatgatcccccgagctcccc 151  Q
    |||||||||| | |||||||||||||||||| |||||| || | |||||||| |||  ||||||| | |||||| ||||||||    
26900089 ttaaggttttgggtaagagtgtggtgtctctcttgcttgtgggtttgttctagccttgatgtggacggtcccccaagctcccc 26900007  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #31
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 67 - 119
Target Start/End: Complemental strand, 795306 - 795254
Alignment:
67 ccttaaggtttttgataagagtgtggtgtctcttttgcttatgtggttgttct 119  Q
    |||||||||||| | |||||||||||||||||| |||||| || |||||||||    
795306 ccttaaggttttaggtaagagtgtggtgtctctcttgcttgtgcggttgttct 795254  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #32
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 58 - 142
Target Start/End: Complemental strand, 11417060 - 11416976
Alignment:
58 aacccattgccttaaggtttttgataagagtgtggtgtctcttttgcttatgtggttgttctatcctcaatgtggatgatccccc 142  Q
    |||||||||||||||||||||   |||||||||| | ||||| |||||| || | |||||||| | || ||||||||| ||||||    
11417060 aacccattgccttaaggttttgtgtaagagtgtgatctctctcttgcttgtgggattgttctagcttcgatgtggatggtccccc 11416976  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #33
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 61 - 133
Target Start/End: Original strand, 35150084 - 35150156
Alignment:
61 ccattgccttaaggtttttgataagagtgtggtgtctcttttgcttatgtggttgttctatcctcaatgtgga 133  Q
    |||||| ||||||||||| | ||| |||||||||||||| |  ||  ||||||||||||| ||||||||||||    
35150084 ccattgtcttaaggttttgggtaaaagtgtggtgtctctctcactagtgtggttgttctaacctcaatgtgga 35150156  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #34
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 61 - 153
Target Start/End: Original strand, 38427625 - 38427717
Alignment:
61 ccattgccttaaggtttttgataagagtgtggtgtctcttttgcttatgtggttgttctatcctcaatgtggatgatcccccgagctcccctc 153  Q
    |||||| |||||||||||   ||||||||||  |||||| |  ||| || |||||||||| |||| ||||||||||||  |||||||||||||    
38427625 ccattgtcttaaggttttgtgtaagagtgtgacgtctctctcacttgtgcggttgttctaacctcgatgtggatgatcttccgagctcccctc 38427717  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #35
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 58 - 97
Target Start/End: Original strand, 13112612 - 13112651
Alignment:
58 aacccattgccttaaggtttttgataagagtgtggtgtct 97  Q
    ||||||||| ||||||||||| ||||||||||||||||||    
13112612 aacccattgtcttaaggttttggataagagtgtggtgtct 13112651  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #36
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 58 - 125
Target Start/End: Complemental strand, 13415843 - 13415776
Alignment:
58 aacccattgccttaaggtttttgataagagtgtggtgtctcttttgcttatgtggttgttctatcctc 125  Q
    |||| ||| |||||||||||| | ||||||||||| |||||| |||||| || |||||||||| ||||    
13415843 aacctattaccttaaggttttgggtaagagtgtggcgtctctcttgcttgtgcggttgttctagcctc 13415776  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #37
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 58 - 120
Target Start/End: Complemental strand, 24489289 - 24489227
Alignment:
58 aacccattgccttaaggtttttgataagagtgtggtgtctcttttgcttatgtggttgttcta 120  Q
    |||||||||||||||| ||||   ||||||||||| ||||||||| ||| || ||||||||||    
24489289 aacccattgccttaagattttgcgtaagagtgtggcgtctcttttacttgtgcggttgttcta 24489227  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #38
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 58 - 152
Target Start/End: Original strand, 41632857 - 41632950
Alignment:
58 aacccattgccttaaggtttttgataagagtgtggtgtctcttttgcttatgtggttgttctatcctcaatgtggatgatcccccgagctcccct 152  Q
    |||||| ||| ||||| |||| | |||||||||||||||||| |||||| || ||||||| ||  ||| ||||||| | |||||| |||||||||    
41632857 aacccaatgctttaagattttgggtaagagtgtggtgtctctcttgcttgtgcggttgttttagtctcgatgtggacggtccccc-agctcccct 41632950  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #39
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 65 - 148
Target Start/End: Complemental strand, 26590986 - 26590902
Alignment:
65 tgccttaaggtttttgataagagtgtggtgtctcttttgcttatgtggttgttctatcctcaatgtggat-gatcccccgagctc 148  Q
    ||||||||||||||   ||||||||||| |||||| |  ||  ||||||||||||| |||| |||||||| | ||||||||||||    
26590986 tgccttaaggttttgagtaagagtgtggcgtctctctcactagtgtggttgttctaacctcgatgtggatggttcccccgagctc 26590902  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #40
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 82 - 150
Target Start/End: Original strand, 38427318 - 38427386
Alignment:
82 taagagtgtggtgtctcttttgcttatgtggttgttctatcctcaatgtggatgatcccccgagctccc 150  Q
    ||||||||||| |||||| |||||| || |||||||||| |||| |||| |  | ||||||||||||||    
38427318 taagagtgtggcgtctctcttgcttgtgcggttgttctaacctcgatgttggcggtcccccgagctccc 38427386  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 61; Significance: 4e-26; HSPs: 31)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 61; E-Value: 4e-26
Query Start/End: Original strand, 58 - 150
Target Start/End: Complemental strand, 36178688 - 36178596
Alignment:
58 aacccattgccttaaggtttttgataagagtgtggtgtctcttttgcttatgtggttgttctatcctcaatgtggatgatcccccgagctccc 150  Q
    ||||||||||||||||||||| | |||||||||||||||||| |||||| ||||||||||||| |||| ||||||| ||||||||| ||||||    
36178688 aacccattgccttaaggttttgggtaagagtgtggtgtctctcttgcttgtgtggttgttctagcctctatgtggacgatcccccgcgctccc 36178596  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 58 - 151
Target Start/End: Complemental strand, 5542708 - 5542615
Alignment:
58 aacccattgccttaaggtttttgataagagtgtggtgtctcttttgcttatgtggttgttctatcctcaatgtggatgatcccccgagctcccc 151  Q
    |||| |||||||||||||||||| |||||||||||||||||| |||||| || |||||||| |  ||| ||||||| | |||||||||||||||    
5542708 aacctattgccttaaggtttttggtaagagtgtggtgtctctcttgcttgtgcggttgttcaagtctcgatgtggacggtcccccgagctcccc 5542615  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 58 - 154
Target Start/End: Original strand, 6421806 - 6421902
Alignment:
58 aacccattgccttaaggtttttgataagagtgtggtgtctcttttgcttatgtggttgttctatcctcaatgtggatgatcccccgagctcccctca 154  Q
    |||| |||||||||||||||| | |||||||||||||||||| |  ||| ||||||||||||  |||| ||||||| | ||||||||||||||||||    
6421806 aacctattgccttaaggttttgggtaagagtgtggtgtctctctaacttgtgtggttgttctggcctcgatgtggacggtcccccgagctcccctca 6421902  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #4
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 62 - 153
Target Start/End: Original strand, 6421464 - 6421555
Alignment:
62 cattgccttaaggtttttgataagagtgtggtgtctcttttgcttatgtggttgttctatcctcaatgtggatgatcccccgagctcccctc 153  Q
    ||||||||| ||||||| | |||||||||||||||||| |||||| || ||||||||||  ||| ||||||| | |||||||||||||||||    
6421464 cattgccttgaggttttgggtaagagtgtggtgtctctcttgcttgtgcggttgttctagtctcgatgtggacggtcccccgagctcccctc 6421555  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #5
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 58 - 133
Target Start/End: Original strand, 6422185 - 6422260
Alignment:
58 aacccattgccttaaggtttttgataagagtgtggtgtctcttttgcttatgtggttgttctatcctcaatgtgga 133  Q
    ||||||| ||||||||||||| | |||||||||||||||||| |||||| ||||||||||||| |||| |||||||    
6422185 aacccatagccttaaggttttaggtaagagtgtggtgtctctcttgcttgtgtggttgttctagcctcgatgtgga 6422260  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #6
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 62 - 152
Target Start/End: Original strand, 37106003 - 37106093
Alignment:
62 cattgccttaaggtttttgataagagtgtggtgtctcttttgcttatgtggttgttctatcctcaatgtggatgatcccccgagctcccct 152  Q
    |||||||||||| |||| | |||||||||||||||||| |||||| |  |||||||||| |||| ||||||| | ||||||||||||||||    
37106003 cattgccttaagattttgggtaagagtgtggtgtctctcttgcttgtacggttgttctagcctcgatgtggacggtcccccgagctcccct 37106093  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #7
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 58 - 151
Target Start/End: Complemental strand, 14745750 - 14745657
Alignment:
58 aacccattgccttaaggtttttgataagagtgtggtgtctcttttgcttatgtggttgttctatcctcaatgtggatgatcccccgagctcccc 151  Q
    ||||||||||||||||||||| | ||||||||||| |||||| ||||   ||||||||||||| |||| |||||||   |||||||||||||||    
14745750 aacccattgccttaaggttttgggtaagagtgtggcgtctctcttgcaagtgtggttgttctagcctcgatgtggacagtcccccgagctcccc 14745657  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #8
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 58 - 151
Target Start/End: Complemental strand, 15511578 - 15511486
Alignment:
58 aacccattgccttaaggtttttgataagagtgtggtgtctcttttgcttatgtggttgttctatcctcaatgtggatgatcccccgagctcccc 151  Q
    ||||||||| |||||| |||| | |||||||||||||||||| |||||| |||||||||||||  ||| ||||||| ||| |||||||||||||    
15511578 aacccattgtcttaagattttgggtaagagtgtggtgtctctcttgcttgtgtggttgttctagtctcgatgtggacgat-ccccgagctcccc 15511486  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #9
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 58 - 154
Target Start/End: Original strand, 23346311 - 23346407
Alignment:
58 aacccattgccttaaggtttttgataagagtgtggtgtctcttttgcttatgtggttgttctatcctcaatgtggatgatcccccgagctcccctca 154  Q
    ||||||| ||||||||||||| | |||||||||| ||||||| |||||| || |||||||||| |||  ||||||| | || |||||||||||||||    
23346311 aacccatagccttaaggttttcggtaagagtgtgatgtctctcttgcttgtgcggttgttctagcctagatgtggacggtcgcccgagctcccctca 23346407  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #10
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 58 - 149
Target Start/End: Original strand, 15880338 - 15880429
Alignment:
58 aacccattgccttaaggtttttgataagagtgtggtgtctcttttgcttatgtggttgttctatcctcaatgtggatgatcccccgagctcc 149  Q
    ||||||||||||||||||||| | ||||||||||| |||||| |||||| || ||||||| || |||| ||||||| | ||| |||||||||    
15880338 aacccattgccttaaggttttgggtaagagtgtggcgtctctcttgcttgtgcggttgttttagcctcgatgtggacgttcctccgagctcc 15880429  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #11
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 58 - 153
Target Start/End: Complemental strand, 36178254 - 36178159
Alignment:
58 aacccattgccttaaggtttttgataagagtgtggtgtctcttttgcttatgtggttgttctatcctcaatgtggatgatcccccgagctcccctc 153  Q
    |||||||||||||||| |||| | ||||||||||||| |||| |||||| |||||||||| || |||| |||| || | ||||||| |||||||||    
36178254 aacccattgccttaagattttgggtaagagtgtggtgcctctcttgcttgtgtggttgttatagcctcgatgtagacggtcccccgcgctcccctc 36178159  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #12
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 58 - 153
Target Start/End: Original strand, 42514724 - 42514819
Alignment:
58 aacccattgccttaaggtttttgataagagtgtggtgtctcttttgcttatgtggttgttctatcctcaatgtggatgatcccccgagctcccctc 153  Q
    ||||||| |||||||| |||| | ||||||||||| |||||| || ||| || |||||||||| |||| ||||||| | |||||||||||||||||    
42514724 aacccatcgccttaagattttgggtaagagtgtggcgtctctcttacttgtggggttgttctagcctcgatgtggacggtcccccgagctcccctc 42514819  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #13
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 58 - 151
Target Start/End: Original strand, 962673 - 962766
Alignment:
58 aacccattgccttaaggtttttgataagagtgtggtgtctcttttgcttatgtggttgttctatcctcaatgtggatgatcccccgagctcccc 151  Q
    ||||||||| ||||||||||| | |||||||||| |||| || |||||| ||||||||||||| |||| ||||||| | || ||||| ||||||    
962673 aacccattgtcttaaggttttgggtaagagtgtgttgtcactcttgcttgtgtggttgttctagcctcgatgtggacggtctcccgaactcccc 962766  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #14
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 58 - 130
Target Start/End: Original strand, 33731723 - 33731795
Alignment:
58 aacccattgccttaaggtttttgataagagtgtggtgtctcttttgcttatgtggttgttctatcctcaatgt 130  Q
    |||| |||||||||||||||| | ||||||| |||||||||| ||||||||| |||||||||| |||| ||||    
33731723 aacctattgccttaaggttttgggtaagagtatggtgtctctcttgcttatgcggttgttctagcctcgatgt 33731795  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #15
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 62 - 154
Target Start/End: Complemental strand, 41283554 - 41283462
Alignment:
62 cattgccttaaggtttttgataagagtgtggtgtctcttttgcttatgtggttgttctatcctcaatgtggatgatcccccgagctcccctca 154  Q
    ||||||||||||||||| | ||||||||||| |||||| ||| || ||||||||||||| |||  ||||||| | ||||||  ||||||||||    
41283554 cattgccttaaggttttaggtaagagtgtggcgtctctcttgtttgtgtggttgttctagccttgatgtggacggtcccccatgctcccctca 41283462  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #16
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 69 - 151
Target Start/End: Complemental strand, 40163444 - 40163362
Alignment:
69 ttaaggtttttgataagagtgtggtgtctcttttgcttatgtggttgttctatcctcaatgtggatgatcccccgagctcccc 151  Q
    |||||||||| | ||| |||||||||||||| |||||| ||||||||||||| |||| |||| |||| || || |||||||||    
40163444 ttaaggttttgggtaaaagtgtggtgtctctcttgcttgtgtggttgttctaacctcgatgtagatggtctcctgagctcccc 40163362  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #17
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 58 - 142
Target Start/End: Complemental strand, 35580807 - 35580723
Alignment:
58 aacccattgccttaaggtttttgataagagtgtggtgtctcttttgcttatgtggttgttctatcctcaatgtggatgatccccc 142  Q
    ||||||||||||||||||||| | |||||||| || |||||| ||| || || |||||||||| |||| ||||||| | ||||||    
35580807 aacccattgccttaaggttttgggtaagagtgcggcgtctctcttgtttgtggggttgttctagcctcgatgtggacggtccccc 35580723  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #18
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 58 - 133
Target Start/End: Original strand, 3672776 - 3672851
Alignment:
58 aacccattgccttaaggtttttgataagagtgtggtgtctcttttgcttatgtggttgttctatcctcaatgtgga 133  Q
    |||||||||||||||| |||| | |||||||||||||||||| ||  || |||||||||||||  ||| |||||||    
3672776 aacccattgccttaagattttgggtaagagtgtggtgtctctcttaattgtgtggttgttctagtctcgatgtgga 3672851  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #19
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 58 - 133
Target Start/End: Complemental strand, 5543081 - 5543006
Alignment:
58 aacccattgccttaaggtttttgataagagtgtggtgtctcttttgcttatgtggttgttctatcctcaatgtgga 133  Q
    |||| ||||||||||| |||| | |||||||||||||||||| |||||| || |||||||| | |||| |||||||    
5543081 aacctattgccttaagattttgggtaagagtgtggtgtctctattgcttgtgcggttgttcaagcctcgatgtgga 5543006  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #20
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 62 - 133
Target Start/End: Complemental strand, 36005959 - 36005888
Alignment:
62 cattgccttaaggtttttgataagagtgtggtgtctcttttgcttatgtggttgttctatcctcaatgtgga 133  Q
    ||||||||||||||||| | ||| ||||||| |||||| |||||| || |||||||||| |||| |||||||    
36005959 cattgccttaaggttttgggtaaaagtgtggcgtctctcttgcttgtggggttgttctagcctcgatgtgga 36005888  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #21
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 58 - 133
Target Start/End: Original strand, 37106263 - 37106338
Alignment:
58 aacccattgccttaaggtttttgataagagtgtggtgtctcttttgcttatgtggttgttctatcctcaatgtgga 133  Q
    |||||||| |||||||||||| | |||||||||||||| ||| |||||| || | |||||||| |||| |||||||    
37106263 aacccatttccttaaggttttgggtaagagtgtggtgtttctcttgcttgtgcgattgttctagcctcgatgtgga 37106338  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #22
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 81 - 151
Target Start/End: Original strand, 1769990 - 1770060
Alignment:
81 ataagagtgtggtgtctcttttgcttatgtggttgttctatcctcaatgtggatgatcccccgagctcccc 151  Q
    ||||||||||||||||||| |||||| || |||||||||| |||| ||||| | ||||| || ||||||||    
1769990 ataagagtgtggtgtctctcttgcttgtgaggttgttctagcctcgatgtgaacgatcctcctagctcccc 1770060  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #23
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 62 - 165
Target Start/End: Original strand, 3673147 - 3673249
Alignment:
62 cattgccttaaggtttttgataagagtgtggtgtctcttttgcttatgtggttgttctatcctcaatgtggatgatcccccgagctcccctcagtgtccc 161  Q
    |||||| ||||| |||| | |||||||||| ||||||| || ||  ||||||||||||| |||| ||||||| | ||||||  ||||||| ||||| |||    
3673147 cattgctttaagattttggctaagagtgtgatgtctctcttactagtgtggttgttctagcctcgatgtggacggtccccctggctcccc-cagtgaccc 3673245  T
162 aaca 165  Q
    ||||    
3673246 aaca 3673249  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #24
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 62 - 165
Target Start/End: Original strand, 16590962 - 16591065
Alignment:
62 cattgccttaaggtttttgataagagtgtggtgtctcttttgcttatgtggttgttctatcctcaatgtggatgatcccccgagctcccctcagtgtccc 161  Q
    |||||||||||||||||   ||||| | |  ||||||| || ||| || |||||||||| ||||||||||||   || ||||||||||||||| || |||    
16590962 cattgccttaaggttttaagtaagaatctaatgtctctcttacttgtggggttgttctagcctcaatgtggacagtctcccgagctcccctcaatgaccc 16591061  T
162 aaca 165  Q
    ||||    
16591062 aaca 16591065  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #25
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 58 - 97
Target Start/End: Complemental strand, 29874106 - 29874067
Alignment:
58 aacccattgccttaaggtttttgataagagtgtggtgtct 97  Q
    ||||||||||||||||||||| ||||||||||||| ||||    
29874106 aacccattgccttaaggttttggataagagtgtggcgtct 29874067  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #26
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 58 - 101
Target Start/End: Complemental strand, 37895144 - 37895101
Alignment:
58 aacccattgccttaaggtttttgataagagtgtggtgtctcttt 101  Q
    ||||||||||||||||||||| | |||||||||||||| |||||    
37895144 aacccattgccttaaggttttgggtaagagtgtggtgtttcttt 37895101  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #27
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 58 - 140
Target Start/End: Original strand, 29676983 - 29677065
Alignment:
58 aacccattgccttaaggtttttgataagagtgtggtgtctcttttgcttatgtggttgttctatcctcaatgtggatgatccc 140  Q
    ||||||||||||||||| |||   |||||||||||||||||| ||  || || |||||||| | |||| ||||||||| ||||    
29676983 aacccattgccttaaggctttaagtaagagtgtggtgtctctcttaattgtggggttgttccaacctcgatgtggatggtccc 29677065  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #28
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 62 - 131
Target Start/End: Complemental strand, 12529107 - 12529038
Alignment:
62 cattgccttaaggtttttgataagagtgtggtgtctcttttgcttatgtggttgttctatcctcaatgtg 131  Q
    ||||||||||| ||||| |||||||  || |||||||| ||| || || |||||||||| ||||||||||    
12529107 cattgccttaaagttttagataagaacgtagtgtctctcttgtttgtgcggttgttctaacctcaatgtg 12529038  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #29
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 58 - 99
Target Start/End: Complemental strand, 14745377 - 14745336
Alignment:
58 aacccattgccttaaggtttttgataagagtgtggtgtctct 99  Q
    ||||||||||||||||||||| | ||||||||||| ||||||    
14745377 aacccattgccttaaggttttgggtaagagtgtggcgtctct 14745336  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #30
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 62 - 99
Target Start/End: Complemental strand, 28254316 - 28254279
Alignment:
62 cattgccttaaggtttttgataagagtgtggtgtctct 99  Q
    ||||||||||||||||| | ||||||||||||||||||    
28254316 cattgccttaaggttttgggtaagagtgtggtgtctct 28254279  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #31
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 58 - 114
Target Start/End: Complemental strand, 36784343 - 36784287
Alignment:
58 aacccattgccttaaggtttttgataagagtgtggtgtctcttttgcttatgtggtt 114  Q
    ||||| ||| ||||||||||| ||||| ||||| |||||||| |||||| |||||||    
36784343 aaccctttgtcttaaggttttggataaaagtgttgtgtctctcttgcttgtgtggtt 36784287  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 59; Significance: 7e-25; HSPs: 32)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 59; E-Value: 7e-25
Query Start/End: Original strand, 61 - 147
Target Start/End: Original strand, 1846826 - 1846912
Alignment:
61 ccattgccttaaggtttttgataagagtgtggtgtctcttttgcttatgtggttgttctatcctcaatgtggatgatcccccgagct 147  Q
    |||||||||||||||||| ||||||||||||||||||||||||||| || |||||||||| |||| ||||||| | |||||||||||    
1846826 ccattgccttaaggttttggataagagtgtggtgtctcttttgcttgtgcggttgttctagcctcgatgtggacggtcccccgagct 1846912  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 58 - 153
Target Start/End: Original strand, 16454650 - 16454745
Alignment:
58 aacccattgccttaaggtttttgataagagtgtggtgtctcttttgcttatgtggttgttctatcctcaatgtggatgatcccccgagctcccctc 153  Q
    |||||||||||||||| |||| ||||||||||||| |||||| |||||| || |||||||||| |||| ||||||| | |||||||||||||||||    
16454650 aacccattgccttaagattttggataagagtgtggcgtctctcttgcttgtgcggttgttctagcctcgatgtggacggtcccccgagctcccctc 16454745  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 58 - 154
Target Start/End: Complemental strand, 2578526 - 2578430
Alignment:
58 aacccattgccttaaggtttttgataagagtgtggtgtctcttttgcttatgtggttgttctatcctcaatgtggatgatcccccgagctcccctca 154  Q
    ||||||| ||||||||||||| | ||||||||||||||||||||||||| || |||||||||| |||| ||||||| | |||||| ||| |||||||    
2578526 aacccatagccttaaggttttgggtaagagtgtggtgtctcttttgcttgtgcggttgttctagcctcgatgtggacggtccccctagcccccctca 2578430  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #4
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 58 - 154
Target Start/End: Original strand, 16454982 - 16455078
Alignment:
58 aacccattgccttaaggtttttgataagagtgtggtgtctcttttgcttatgtggttgttctatcctcaatgtggatgatcccccgagctcccctca 154  Q
    |||| |||||||||||||||| | ||||||||||| |||||| |||||| || |||||||||| |||| ||||||| | ||||||||||||||||||    
16454982 aacctattgccttaaggttttgggtaagagtgtggcgtctctcttgcttgtgcggttgttctagcctcgatgtggacggtcccccgagctcccctca 16455078  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #5
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 58 - 152
Target Start/End: Original strand, 3415533 - 3415629
Alignment:
58 aacccattgccttaaggtttttgataagagtgtggtgtctcttttgcttatgtggttgt--tctatcctcaatgtggatgatcccccgagctcccct 152  Q
    ||||||||||||||||||||||| |||||||||||||||||| |||||| || ||||||  |||| |||| ||||||| | |||||| |||||||||    
3415533 aacccattgccttaaggtttttggtaagagtgtggtgtctctcttgcttgtgcggttgttctctagcctcgatgtggaaggtcccccaagctcccct 3415629  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #6
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 62 - 154
Target Start/End: Complemental strand, 2578914 - 2578822
Alignment:
62 cattgccttaaggtttttgataagagtgtggtgtctcttttgcttatgtggttgttctatcctcaatgtggatgatcccccgagctcccctca 154  Q
    |||| |||||||||||| | ||||||||||||||||||||||||| ||||||||||||  |||| ||||||| | ||||||  ||||||||||    
2578914 cattaccttaaggttttgggtaagagtgtggtgtctcttttgcttgtgtggttgttctgacctcgatgtggacggtcccccaggctcccctca 2578822  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #7
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 58 - 154
Target Start/End: Original strand, 29518578 - 29518674
Alignment:
58 aacccattgccttaaggtttttgataagagtgtggtgtctcttttgcttatgtggttgttctatcctcaatgtggatgatcccccgagctcccctca 154  Q
    |||||||| |||||||||||| | |||||||||||||||||| |||||| || |||||||||| |||| ||||||| | ||||||| ||||| ||||    
29518578 aacccattaccttaaggttttgggtaagagtgtggtgtctctcttgcttgtgcggttgttctagcctcgatgtggacggtcccccgcgctcctctca 29518674  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #8
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 58 - 154
Target Start/End: Original strand, 29518995 - 29519091
Alignment:
58 aacccattgccttaaggtttttgataagagtgtggtgtctcttttgcttatgtggttgttctatcctcaatgtggatgatcccccgagctcccctca 154  Q
    |||||||| |||||||||||| | |||||||||||||||||| |||||| || |||||||||| |||| ||||||| | ||||||| ||||| ||||    
29518995 aacccattaccttaaggttttgggtaagagtgtggtgtctctcttgcttgtgcggttgttctagcctcgatgtggacggtcccccgcgctcctctca 29519091  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #9
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 58 - 154
Target Start/End: Original strand, 32741254 - 32741350
Alignment:
58 aacccattgccttaaggtttttgataagagtgtggtgtctcttttgcttatgtggttgttctatcctcaatgtggatgatcccccgagctcccctca 154  Q
    |||||||| |||||||||||| | |||||||||||||||||| |||||| || |||||||||| |||| ||||||| | ||||||| ||||| ||||    
32741254 aacccattaccttaaggttttgggtaagagtgtggtgtctctcttgcttgtgcggttgttctagcctcgatgtggacggtcccccgcgctcctctca 32741350  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #10
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 58 - 165
Target Start/End: Original strand, 2377829 - 2377935
Alignment:
58 aacccattgccttaaggtttttgataagagtgtggtgtctcttttgcttatgtggttgttctatcctcaatgtggatgatcccccgagctcccctcagtg 157  Q
    ||||||||||||||||||||| | |||||||||||||||| | ||||||  |||||| ||||| |||| ||||||| | ||||||||||| ||| |||||    
2377829 aacccattgccttaaggttttgggtaagagtgtggtgtctttcttgcttgagtggtttttctagcctcgatgtggaaggtcccccgagcttccc-cagtg 2377927  T
158 tcccaaca 165  Q
     |||||||    
2377928 acccaaca 2377935  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #11
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 58 - 147
Target Start/End: Original strand, 2378201 - 2378290
Alignment:
58 aacccattgccttaaggtttttgataagagtgtggtgtctcttttgcttatgtggttgttctatcctcaatgtggatgatcccccgagct 147  Q
    |||||||| |||||||||||| | ||||| |||||||||||| ||||||  |||||||||||| |||| ||||||| | |||||||||||    
2378201 aacccattaccttaaggttttaggtaagaatgtggtgtctctcttgcttgagtggttgttctagcctcgatgtggacggtcccccgagct 2378290  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #12
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 62 - 154
Target Start/End: Original strand, 2843634 - 2843726
Alignment:
62 cattgccttaaggtttttgataagagtgtggtgtctcttttgcttatgtggttgttctatcctcaatgtggatgatcccccgagctcccctca 154  Q
    ||||||||||||||||| | |||||||||||| ||||| ||||||  |||||||||||| |||| ||||||| | |||||| | |||||||||    
2843634 cattgccttaaggttttgggtaagagtgtggtatctctcttgcttgagtggttgttctagcctcgatgtggacggtccccctaactcccctca 2843726  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #13
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 58 - 165
Target Start/End: Original strand, 16107753 - 16107861
Alignment:
58 aacccattgccttaaggtttttgataagagtgtggtgtctcttttgcttatgtggttgttctatcctcaatgtggatgatcccccgagctcccc-tcagt 156  Q
    ||||||||||||||||||||| | |||||||||||||||||| |||||| || ||||| |||| |||| |||||| || | |||| | |||||| |||||    
16107753 aacccattgccttaaggttttgggtaagagtgtggtgtctctcttgcttgtgcggttgctctagcctcgatgtgggtggtacccctaactccccttcagt 16107852  T
157 gtcccaaca 165  Q
    | |||||||    
16107853 gacccaaca 16107861  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #14
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 58 - 153
Target Start/End: Original strand, 1127435 - 1127530
Alignment:
58 aacccattgccttaaggtttttgataagagtgtggtgtctcttttgcttatgtggttgttctatcctcaatgtggatgatcccccgagctcccctc 153  Q
    |||||||| |||||||||||| | ||||||||||| |||||| || |||||||||||| |||| |||| |||||| || |||||  ||||||||||    
1127435 aacccattaccttaaggttttgggtaagagtgtggcgtctctcttacttatgtggttgctctaacctcgatgtgggtggtccccaaagctcccctc 1127530  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #15
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 62 - 135
Target Start/End: Complemental strand, 2579571 - 2579498
Alignment:
62 cattgccttaaggtttttgataagagtgtggtgtctcttttgcttatgtggttgttctatcctcaatgtggatg 135  Q
    ||||||||||||||||| | ||| ||| |||||||||| |||||| ||||||||||||| |||| |||||||||    
2579571 cattgccttaaggttttgggtaaaagtatggtgtctctcttgcttgtgtggttgttctaacctcgatgtggatg 2579498  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #16
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 62 - 131
Target Start/End: Original strand, 3409338 - 3409407
Alignment:
62 cattgccttaaggtttttgataagagtgtggtgtctcttttgcttatgtggttgttctatcctcaatgtg 131  Q
    ||||||||||||||||| | |||||||||||||||||| |||||| || |||||||||| |||| |||||    
3409338 cattgccttaaggttttgggtaagagtgtggtgtctctcttgcttgtgcggttgttctagcctcgatgtg 3409407  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #17
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 65 - 133
Target Start/End: Complemental strand, 6999872 - 6999804
Alignment:
65 tgccttaaggtttttgataagagtgtggtgtctcttttgcttatgtggttgttctatcctcaatgtgga 133  Q
    |||||||||||||| ||||||||||||| |||||| ||||| ||||||||||||||  ||| |||||||    
6999872 tgccttaaggttttggataagagtgtggcgtctctcttgctaatgtggttgttctagtctcgatgtgga 6999804  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #18
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 61 - 133
Target Start/End: Original strand, 35210282 - 35210354
Alignment:
61 ccattgccttaaggtttttgataagagtgtggtgtctcttttgcttatgtggttgttctatcctcaatgtgga 133  Q
    |||||||||||||||||| | |||||||||||||| |||||||||| || ||||| |||| |||| |||||||    
35210282 ccattgccttaaggttttgggtaagagtgtggtgtttcttttgcttgtgcggttgctctagcctcgatgtgga 35210354  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #19
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 58 - 133
Target Start/End: Original strand, 3058301 - 3058376
Alignment:
58 aacccattgccttaaggtttttgataagagtgtggtgtctcttttgcttatgtggttgttctatcctcaatgtgga 133  Q
    ||||||||||||||||||||| | |||||||||||||||||| |||||| |  ||| |||||| |||| |||||||    
3058301 aacccattgccttaaggttttgggtaagagtgtggtgtctctcttgcttgtagggtggttctaacctcgatgtgga 3058376  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #20
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 58 - 125
Target Start/End: Complemental strand, 10074074 - 10074007
Alignment:
58 aacccattgccttaaggtttttgataagagtgtggtgtctcttttgcttatgtggttgttctatcctc 125  Q
    ||||||||||||||||||||| | ||| |||||||||||||| | |||||| ||||||||||| ||||    
10074074 aacccattgccttaaggttttgggtaaaagtgtggtgtctctctcgcttatttggttgttctagcctc 10074007  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #21
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 62 - 152
Target Start/End: Complemental strand, 10074442 - 10074352
Alignment:
62 cattgccttaaggtttttgataagagtgtggtgtctcttttgcttatgtggttgttctatcctcaatgtggatgatcccccgagctcccct 152  Q
    ||||||||||||||||| | |||||||||||||||||| |  ||  ||||||||||||| |||| ||||||||  ||||||  ||||||||    
10074442 cattgccttaaggttttgggtaagagtgtggtgtctctctcactagtgtggttgttctagcctcgatgtggatagtcccccaggctcccct 10074352  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #22
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 66 - 154
Target Start/End: Complemental strand, 2579947 - 2579860
Alignment:
66 gccttaaggtttttgataagagtgtggtgtctcttttgcttatgtggttgttctatcctcaatgtggatgatcccccgagctcccctca 154  Q
    ||||||||||||| | ||||| |||||||||||| |||||| || |||||||||| |||| ||||||| | | |||| |||||||||||    
2579947 gccttaaggttttgggtaagaatgtggtgtctctcttgcttgtgcggttgttctagcctcgatgtggaaggt-ccccaagctcccctca 2579860  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #23
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 58 - 142
Target Start/End: Original strand, 3409735 - 3409819
Alignment:
58 aacccattgccttaaggtttttgataagagtgtggtgtctcttttgcttatgtggttgttctatcctcaatgtggatgatccccc 142  Q
    ||||||||||||| |  |||| | |||||||||||||||||| |||||| || |||||||||| |||| ||||||| | ||||||    
3409735 aacccattgcctttattttttgggtaagagtgtggtgtctctcttgcttgtgcggttgttctagcctcgatgtggacggtccccc 3409819  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #24
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 69 - 154
Target Start/End: Complemental strand, 2579181 - 2579097
Alignment:
69 ttaaggtttttgataagagtgtggtgtctcttttgcttatgtggttgttctatcctcaatgtggatgatcccccgagctcccctca 154  Q
    |||||| ||| | |||||||||||||||||| |||||  ||||||||||||| |||| ||||| | | | ||||||||||||||||    
2579181 ttaaggctttggctaagagtgtggtgtctctcttgctcgtgtggttgttctagcctcgatgtgcacggt-ccccgagctcccctca 2579097  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #25
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 62 - 151
Target Start/End: Complemental strand, 14748417 - 14748332
Alignment:
62 cattgccttaaggtttttgataagagtgtggtgtctcttttgcttatgtggttgttctatcctcaatgtggatgatcccccgagctcccc 151  Q
    |||||| |||||||||| | |||||||||||| |||    ||||| ||||||||||||| |||| ||||||| | ||||||| |||||||    
14748417 cattgcgttaaggttttgggtaagagtgtggtctct----tgcttgtgtggttgttctagcctcgatgtggacggtcccccgcgctcccc 14748332  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #26
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 67 - 154
Target Start/End: Complemental strand, 12071765 - 12071678
Alignment:
67 ccttaaggtttttgataagagtgtggtgtctcttttgcttatgtggttgttctatcctcaatgtggatgatcccccgagctcccctca 154  Q
    |||||||||||| | ||||||||||| |||||| |  ||| ||||||||||||| |||| ||||| | | |||||  |||||||||||    
12071765 ccttaaggttttgggtaagagtgtggcgtctctctcacttgtgtggttgttctagcctcgatgtgaacggtcccctaagctcccctca 12071678  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #27
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 66 - 165
Target Start/End: Original strand, 26544132 - 26544230
Alignment:
66 gccttaaggtttttgataagagtgtggtgtctcttttgcttatgtggttgttctatcctcaatgtggatgatcccccgagctcccctcagtgtcccaaca 165  Q
    |||||||||||||   |||||||||| ||||||| |||||| || | |||||||| |||||||||| |   ||||||||||| ||| ||||| |||||||    
26544132 gccttaaggttttgagtaagagtgtgatgtctctcttgcttgtgcgattgttctagcctcaatgtgaagagtcccccgagcttccc-cagtgacccaaca 26544230  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #28
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 87 - 133
Target Start/End: Original strand, 3409405 - 3409451
Alignment:
87 gtgtggtgtctcttttgcttatgtggttgttctatcctcaatgtgga 133  Q
    ||||||||||||| ||||||||| |||||||||| |||| |||||||    
3409405 gtgtggtgtctctcttgcttatgcggttgttctagcctcgatgtgga 3409451  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #29
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 61 - 95
Target Start/End: Complemental strand, 21130137 - 21130103
Alignment:
61 ccattgccttaaggtttttgataagagtgtggtgt 95  Q
    |||||||||||||||||| ||||||||||||||||    
21130137 ccattgccttaaggttttggataagagtgtggtgt 21130103  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #30
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 58 - 99
Target Start/End: Complemental strand, 11637804 - 11637763
Alignment:
58 aacccattgccttaaggtttttgataagagtgtggtgtctct 99  Q
    ||||||||| |||||| |||| ||||||||||||||||||||    
11637804 aacccattgtcttaagattttggataagagtgtggtgtctct 11637763  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #31
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 61 - 125
Target Start/End: Complemental strand, 12085114 - 12085050
Alignment:
61 ccattgccttaaggtttttgataagagtgtggtgtctcttttgcttatgtggttgttctatcctc 125  Q
    |||| ||||||||||||| | ||||||||||| |||||| |  ||| ||||||||||||| ||||    
12085114 ccatggccttaaggttttgggtaagagtgtggcgtctctctcacttgtgtggttgttctagcctc 12085050  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #32
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 82 - 165
Target Start/End: Original strand, 16108150 - 16108233
Alignment:
82 taagagtgtggtgtctcttttgcttatgtggttgttctatcctcaatgtggatgatccc-ccgagctcccctcagtgtcccaaca 165  Q
    |||| ||||||||||||| |||||| || ||||||| || |||| ||||||| | |||| ||||||||||| ||||| |||||||    
16108150 taagggtgtggtgtctctcttgcttgtggggttgttataacctcgatgtggacggtccctccgagctcccc-cagtgacccaaca 16108233  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 57; Significance: 1e-23; HSPs: 35)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 62 - 154
Target Start/End: Complemental strand, 22567118 - 22567026
Alignment:
62 cattgccttaaggtttttgataagagtgtggtgtctcttttgcttatgtggttgttctatcctcaatgtggatgatcccccgagctcccctca 154  Q
    ||||||||||||||||||| |||||||||||||||||| |||||| || ||||||||   |||| ||||||||| ||||||||||||||||||    
22567118 cattgccttaaggtttttggtaagagtgtggtgtctctcttgcttgtggggttgttcgggcctcgatgtggatggtcccccgagctcccctca 22567026  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 61 - 153
Target Start/End: Complemental strand, 37533444 - 37533352
Alignment:
61 ccattgccttaaggtttttgataagagtgtggtgtctcttttgcttatgtggttgttctatcctcaatgtggatgatcccccgagctcccctc 153  Q
    |||||||||||||||||| | ||||||||||||||||||||||||| || |||||||||| |||| ||||||| | ||||||| |||||||||    
37533444 ccattgccttaaggttttgggtaagagtgtggtgtctcttttgcttgtgcggttgttctagcctcgatgtggacggtcccccgcgctcccctc 37533352  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 58 - 152
Target Start/End: Original strand, 30244345 - 30244439
Alignment:
58 aacccattgccttaaggtttttgataagagtgtggtgtctcttttgcttatgtggttgttctatcctcaatgtggatgatcccccgagctcccct 152  Q
    ||||||||||||||||||||| | |||||||||||||||||| |  ||| ||||||||||| | |||| ||||||||| ||||||||||||||||    
30244345 aacccattgccttaaggttttgggtaagagtgtggtgtctctctcacttgtgtggttgttcaagcctcgatgtggatggtcccccgagctcccct 30244439  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #4
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 58 - 154
Target Start/End: Complemental strand, 1085699 - 1085603
Alignment:
58 aacccattgccttaaggtttttgataagagtgtggtgtctcttttgcttatgtggttgttctatcctcaatgtggatgatcccccgagctcccctca 154  Q
    ||||||||||||||||||||| | ||||||||||| |||||| || ||| ||||||||||||| |||| ||||||| | ||||||  ||||||||||    
1085699 aacccattgccttaaggttttgggtaagagtgtggcgtctctcttacttgtgtggttgttctagcctcgatgtggacggtccccctggctcccctca 1085603  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #5
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 61 - 165
Target Start/End: Original strand, 11845269 - 11845372
Alignment:
61 ccattgccttaaggtttttgataagagtgtggtgtctcttttgcttatgtggttgttctatcctcaatgtggatgatcccccgagctcccctcagtgtcc 160  Q
    |||||||||||||||||| |||||||||||||||||||| |||||| ||  ||||||||| |||| |||| || | ||||||| ||||||| ||||| ||    
11845269 ccattgccttaaggttttggataagagtgtggtgtctctcttgcttgtgcagttgttctagcctcgatgtagacggtcccccgtgctcccc-cagtgacc 11845367  T
161 caaca 165  Q
    |||||    
11845368 caaca 11845372  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #6
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 62 - 153
Target Start/End: Original strand, 30245156 - 30245243
Alignment:
62 cattgccttaaggtttttgataagagtgtggtgtctcttttgcttatgtggttgttctatcctcaatgtggatgatcccccgagctcccctc 153  Q
    ||||||||||||||||| | ||||||||||||||||||    ||| ||||||||||| | |||| ||||||||| |||||||||||||||||    
30245156 cattgccttaaggttttgggtaagagtgtggtgtctct----cttgtgtggttgttcaagcctcgatgtggatggtcccccgagctcccctc 30245243  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #7
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 62 - 153
Target Start/End: Original strand, 30253571 - 30253658
Alignment:
62 cattgccttaaggtttttgataagagtgtggtgtctcttttgcttatgtggttgttctatcctcaatgtggatgatcccccgagctcccctc 153  Q
    ||||||||||||||||| | ||||||||||||||||||    ||| ||||||||||| | |||| ||||||||| |||||||||||||||||    
30253571 cattgccttaaggttttgggtaagagtgtggtgtctct----cttgtgtggttgttcaagcctcgatgtggatggtcccccgagctcccctc 30253658  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #8
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 58 - 150
Target Start/End: Complemental strand, 23460 - 23368
Alignment:
58 aacccattgccttaaggtttttgataagagtgtggtgtctcttttgcttatgtggttgttctatcctcaatgtggatgatcccccgagctccc 150  Q
    |||| |||||||||||||||| | |||||||||||||||||| |||| | || |||||||||| |||| || |||| | ||||||||||||||    
23460 aacctattgccttaaggttttgggtaagagtgtggtgtctctcttgcatgtgcggttgttctagcctcgatttggacggtcccccgagctccc 23368  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #9
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 58 - 165
Target Start/End: Original strand, 7517655 - 7517762
Alignment:
58 aacccattgccttaaggtttttgataagagtgtggtgtctcttttgcttatgtggttgttctatcctcaatgtggatgatcccccgagctcccctcagtg 157  Q
    ||||||||||||||||||||| | |||||||||||||||| | |  ||| ||||||||||||| |||| |||||| || |||||   ||||||||||||     
7517655 aacccattgccttaaggttttgggtaagagtgtggtgtctgtctcacttgtgtggttgttctagcctcgatgtgggtggtccccttggctcccctcagta 7517754  T
158 tcccaaca 165  Q
     |||||||    
7517755 acccaaca 7517762  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #10
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 61 - 135
Target Start/End: Complemental strand, 36939813 - 36939739
Alignment:
61 ccattgccttaaggtttttgataagagtgtggtgtctcttttgcttatgtggttgttctatcctcaatgtggatg 135  Q
    |||||||||||||||||| | ||| |||||||||| ||| ||||||||| |||||||||| |||| |||||||||    
36939813 ccattgccttaaggttttgggtaaaagtgtggtgtttctcttgcttatgcggttgttctagcctcgatgtggatg 36939739  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #11
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 64 - 154
Target Start/End: Original strand, 47129450 - 47129539
Alignment:
64 ttgccttaaggtttttgataagagtgtggtgtctcttttgcttatgtggttgttctatcctcaatgtggatgatcccccgagctcccctca 154  Q
    ||||||||||||||| | |||||||||||||||||| |||||| || ||||| |||| |||| ||||||| | | ||||||||||||||||    
47129450 ttgccttaaggttttgggtaagagtgtggtgtctctcttgcttgtgcggttgatctagcctcgatgtggacggt-ccccgagctcccctca 47129539  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #12
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 66 - 151
Target Start/End: Original strand, 30032650 - 30032735
Alignment:
66 gccttaaggtttttgataagagtgtggtgtctcttttgcttatgtggttgttctatcctcaatgtggatgatcccccgagctcccc 151  Q
    ||||||||||||| | ||||||||||   ||||| |||||| || ||||||||||||||| ||||||| | |||||||||||||||    
30032650 gccttaaggttttgggtaagagtgtgacatctctcttgcttgtgcggttgttctatcctcgatgtggacggtcccccgagctcccc 30032735  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #13
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 58 - 151
Target Start/End: Complemental strand, 34218117 - 34218024
Alignment:
58 aacccattgccttaaggtttttgataagagtgtggtgtctcttttgcttatgtggttgttctatcctcaatgtggatgatcccccgagctcccc 151  Q
    ||||||||| ||||||||||| | |||||||||||||||||| | |||| | ||||||||| | |||| ||||||| | ||| |||||||||||    
34218117 aacccattgtcttaaggttttgggtaagagtgtggtgtctctctcgcttgtatggttgttcaagcctcgatgtggacggtcctccgagctcccc 34218024  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #14
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 61 - 162
Target Start/End: Original strand, 37167859 - 37167960
Alignment:
61 ccattgccttaaggtttttgataagagtgtggtgtctcttttgcttatgtggttgttctatcctcaatgtggatgatcccccgagctcccctcagtgtcc 160  Q
    |||||| ||||| ||||| | |||||||||||||||||| |||||| || |||||||||| |||| ||||||| | ||| ||| ||||||| ||||| ||    
37167859 ccattgacttaaagttttgggtaagagtgtggtgtctctcttgcttgtgcggttgttctagcctcgatgtggacggtcctccgcgctccccccagtgacc 37167958  T
161 ca 162  Q
    ||    
37167959 ca 37167960  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #15
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 58 - 118
Target Start/End: Original strand, 45754790 - 45754850
Alignment:
58 aacccattgccttaaggtttttgataagagtgtggtgtctcttttgcttatgtggttgttc 118  Q
    ||||||| ||||||||||||| | |||||||||||||||||| |||||| |||||||||||    
45754790 aacccatagccttaaggttttgggtaagagtgtggtgtctctcttgcttgtgtggttgttc 45754850  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #16
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 61 - 120
Target Start/End: Original strand, 19122809 - 19122868
Alignment:
61 ccattgccttaaggtttttgataagagtgtggtgtctcttttgcttatgtggttgttcta 120  Q
    |||||||||||||||||| | |||||||||||||||| | |||||| |||||||||||||    
19122809 ccattgccttaaggttttgggtaagagtgtggtgtctatcttgcttgtgtggttgttcta 19122868  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #17
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 58 - 153
Target Start/End: Original strand, 45433316 - 45433411
Alignment:
58 aacccattgccttaaggtttttgataagagtgtggtgtctcttttgcttatgtggttgttctatcctcaatgtggatgatcccccgagctcccctc 153  Q
    |||| ||||||||||| |||| | |||||||||||||||||| |||||| || |||||||||| |||| ||||||  | ||||||  |||||||||    
45433316 aacctattgccttaagattttgggtaagagtgtggtgtctctcttgcttgtggggttgttctagcctcgatgtggtcggtccccctggctcccctc 45433411  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #18
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 62 - 148
Target Start/End: Original strand, 6054639 - 6054725
Alignment:
62 cattgccttaaggtttttgataagagtgtggtgtctcttttgcttatgtggttgttctatcctcaatgtggatgatcccccgagctc 148  Q
    ||||||||||||||||| | ||||||||||||||||||  | ||| | ||||||||||| |||  ||||||| | ||||||||||||    
6054639 cattgccttaaggttttgggtaagagtgtggtgtctctcctacttgtatggttgttctagccttgatgtggacggtcccccgagctc 6054725  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #19
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 62 - 150
Target Start/End: Complemental strand, 37533089 - 37533002
Alignment:
62 cattgccttaaggtttttgataagagtgtggtgtctcttttgcttatgtggttgttctatcctcaatgtggatgatcccccgagctccc 150  Q
    ||||||||||||||||| | ||| |||||||||||||| |||||| || | |||||||| |||| ||||||| | ||||||| ||||||    
37533089 cattgccttaaggttttgggtaa-agtgtggtgtctctcttgcttgtgcgcttgttctaacctcgatgtggacggtcccccgcgctccc 37533002  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #20
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 66 - 140
Target Start/End: Complemental strand, 28300644 - 28300569
Alignment:
66 gccttaaggtttttga-taagagtgtggtgtctcttttgcttatgtggttgttctatcctcaatgtggatgatccc 140  Q
    ||||||||||||| |  |||||||||||||||||| |||||| ||||||| ||||| |||| ||||||| ||||||    
28300644 gccttaaggttttggggtaagagtgtggtgtctctcttgcttgtgtggttattctagcctcgatgtggacgatccc 28300569  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #21
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 58 - 145
Target Start/End: Complemental strand, 40094857 - 40094770
Alignment:
58 aacccattgccttaaggtttttgataagagtgtggtgtctcttttgcttatgtggttgttctatcctcaatgtggatgatcccccgag 145  Q
    ||||||| | ||||||||||| | ||||||||||| |||||| |||||| || |||||||||| |||| ||||||  | |||||||||    
40094857 aacccatcgtcttaaggttttgggtaagagtgtggcgtctctcttgcttgtgaggttgttctagcctcgatgtggtcggtcccccgag 40094770  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #22
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 58 - 120
Target Start/End: Complemental strand, 8128524 - 8128462
Alignment:
58 aacccattgccttaaggtttttgataagagtgtggtgtctcttttgcttatgtggttgttcta 120  Q
    |||||||  |||||||||||| | ||||||||||||||| || | ||||||||||||||||||    
8128524 aacccataaccttaaggttttggttaagagtgtggtgtcactctcgcttatgtggttgttcta 8128462  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #23
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 58 - 116
Target Start/End: Original strand, 24177510 - 24177568
Alignment:
58 aacccattgccttaaggtttttgataagagtgtggtgtctcttttgcttatgtggttgt 116  Q
    ||||||||||||||| ||||||| ||||||||||| |||||| |||||| || ||||||    
24177510 aacccattgccttaaagtttttggtaagagtgtggcgtctctcttgcttgtgcggttgt 24177568  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #24
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 58 - 99
Target Start/End: Original strand, 16569271 - 16569312
Alignment:
58 aacccattgccttaaggtttttgataagagtgtggtgtctct 99  Q
    ||||||||||||||||||||||| |||||||| |||||||||    
16569271 aacccattgccttaaggtttttggtaagagtgcggtgtctct 16569312  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #25
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 58 - 99
Target Start/End: Complemental strand, 16596391 - 16596350
Alignment:
58 aacccattgccttaaggtttttgataagagtgtggtgtctct 99  Q
    ||||||||||||||||||||||| |||||||| |||||||||    
16596391 aacccattgccttaaggtttttggtaagagtgcggtgtctct 16596350  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #26
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 61 - 105
Target Start/End: Original strand, 29157643 - 29157687
Alignment:
61 ccattgccttaaggtttttgataagagtgtggtgtctcttttgct 105  Q
    |||||||||||||||||| | |||||||||||||||||| |||||    
29157643 ccattgccttaaggttttgggtaagagtgtggtgtctctcttgct 29157687  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #27
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 62 - 125
Target Start/End: Original strand, 9901722 - 9901785
Alignment:
62 cattgccttaaggtttttgataagagtgtggtgtctcttttgcttatgtggttgttctatcctc 125  Q
    ||||| ||||||||||| | |||||||||||||||||| |||||  || |||||||||| ||||    
9901722 cattgtcttaaggttttgggtaagagtgtggtgtctctcttgctagtgcggttgttctagcctc 9901785  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #28
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 58 - 112
Target Start/End: Original strand, 7554100 - 7554154
Alignment:
58 aacccattgccttaaggtttttgataagagtgtggtgtctcttttgcttatgtgg 112  Q
    ||||||| ||||||||||||| | |||||||||||||||||| | |||| |||||    
7554100 aacccatagccttaaggttttgggtaagagtgtggtgtctctctcgcttgtgtgg 7554154  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #29
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 71 - 153
Target Start/End: Complemental strand, 37532821 - 37532739
Alignment:
71 aaggtttttgataagagtgtggtgtctcttttgcttatgtggttgttctatcctcaatgtggatgatcccccgagctcccctc 153  Q
    |||||||| | |||||||||||||||||| | |||| ||  ||||||||| |||| ||||||| | ||| ||| |||||||||    
37532821 aaggttttgggtaagagtgtggtgtctctctagcttgtgctgttgttctagcctcgatgtggacggtcctccgcgctcccctc 37532739  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #30
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 58 - 99
Target Start/End: Original strand, 14681585 - 14681626
Alignment:
58 aacccattgccttaaggtttttgataagagtgtggtgtctct 99  Q
    ||||||||| ||||||||||| | ||||||||||||||||||    
14681585 aacccattgtcttaaggttttgggtaagagtgtggtgtctct 14681626  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #31
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 58 - 99
Target Start/End: Complemental strand, 21416224 - 21416183
Alignment:
58 aacccattgccttaaggtttttgataagagtgtggtgtctct 99  Q
    |||||||||||||| |||||| | ||||||||||||||||||    
21416224 aacccattgccttagggttttgggtaagagtgtggtgtctct 21416183  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #32
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 58 - 99
Target Start/End: Complemental strand, 23569085 - 23569044
Alignment:
58 aacccattgccttaaggtttttgataagagtgtggtgtctct 99  Q
    ||||||||||||||||||||| | |||||||||| |||||||    
23569085 aacccattgccttaaggttttgggtaagagtgtgatgtctct 23569044  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #33
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 58 - 118
Target Start/End: Complemental strand, 24838784 - 24838724
Alignment:
58 aacccattgccttaaggtttttgataagagtgtggtgtctcttttgcttatgtggttgttc 118  Q
    ||||| ||| ||||||||||| | ||||||||||  |||||| |||||| |||||||||||    
24838784 aacccgttgtcttaaggttttgggtaagagtgtgacgtctctcttgcttgtgtggttgttc 24838724  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #34
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 58 - 118
Target Start/End: Complemental strand, 28300336 - 28300276
Alignment:
58 aacccattgccttaaggtttttgataagagtgtggtgtctcttttgcttatgtggttgttc 118  Q
    |||||||||||||||| |||| | ||||||||||| |||||| ||||   |||||||||||    
28300336 aacccattgccttaagattttgggtaagagtgtggcgtctctcttgcaagtgtggttgttc 28300276  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #35
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 84 - 152
Target Start/End: Original strand, 30245256 - 30245324
Alignment:
84 agagtgtggtgtctcttttgcttatgtggttgttctatcctcaatgtggatgatcccccgagctcccct 152  Q
    |||||||||||||||| |  ||| ||||||||||| | |||||||||||| | ||||||  ||||||||    
30245256 agagtgtggtgtctctctcacttgtgtggttgttcaagcctcaatgtggacggtcccccatgctcccct 30245324  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 57; Significance: 1e-23; HSPs: 36)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 58 - 142
Target Start/End: Complemental strand, 3135537 - 3135453
Alignment:
58 aacccattgccttaaggtttttgataagagtgtggtgtctcttttgcttatgtggttgttctatcctcaatgtggatgatccccc 142  Q
    ||||||||||||||||||||| ||||||||||||||||||||||||||| || |||||||||| |||| ||||||| | ||||||    
3135537 aacccattgccttaaggttttagataagagtgtggtgtctcttttgcttgtgcggttgttctagcctcgatgtggacggtccccc 3135453  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 62 - 165
Target Start/End: Complemental strand, 37990718 - 37990615
Alignment:
62 cattgccttaaggtttttgataagagtgtggtgtctcttttgcttatgtggttgttctatcctcaatgtggatgatcccccgagctcccctcagtgtccc 161  Q
    ||||||||||||||||| | |||||||||||||||||| |||||| |||| |||||||| |||| ||||||| | |||||||||||| ||||| || |||    
37990718 cattgccttaaggttttgggtaagagtgtggtgtctctcttgcttgtgtgattgttctagcctcgatgtggacggtcccccgagctctcctcaatgaccc 37990619  T
162 aaca 165  Q
    ||||    
37990618 aaca 37990615  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 58 - 134
Target Start/End: Complemental strand, 22304038 - 22303962
Alignment:
58 aacccattgccttaaggtttttgataagagtgtggtgtctcttttgcttatgtggttgttctatcctcaatgtggat 134  Q
    ||||||||||||||||||||| |||||||||||||||||||| ||||||  |||||||||||| |||| ||||||||    
22304038 aacccattgccttaaggttttggataagagtgtggtgtctctcttgcttgagtggttgttctagcctcgatgtggat 22303962  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 62 - 133
Target Start/End: Original strand, 15772933 - 15773004
Alignment:
62 cattgccttaaggtttttgataagagtgtggtgtctcttttgcttatgtggttgttctatcctcaatgtgga 133  Q
    |||||| |||||||||| |||||||||||||||||||| |||||| ||||||||||||| |||| |||||||    
15772933 cattgctttaaggttttggataagagtgtggtgtctctcttgcttgtgtggttgttctaacctcgatgtgga 15773004  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #5
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 58 - 153
Target Start/End: Complemental strand, 29644985 - 29644890
Alignment:
58 aacccattgccttaaggtttttgataagagtgtggtgtctcttttgcttatgtggttgttctatcctcaatgtggatgatcccccgagctcccctc 153  Q
    ||||||||| ||||||||||| | ||||||||||| |||||| ||||||||| ||||||| || |||| ||||||| | |||||| ||||||||||    
29644985 aacccattgtcttaaggttttgggtaagagtgtggcgtctctcttgcttatgcggttgttttagcctcgatgtggacggtcccccaagctcccctc 29644890  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #6
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 66 - 133
Target Start/End: Complemental strand, 37991052 - 37990985
Alignment:
66 gccttaaggtttttgataagagtgtggtgtctcttttgcttatgtggttgttctatcctcaatgtgga 133  Q
    ||||||||||||| | |||||||||||||||||| |||||||||||||||||||| |||| |||||||    
37991052 gccttaaggttttgggtaagagtgtggtgtctctcttgcttatgtggttgttctagcctcgatgtgga 37990985  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #7
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 58 - 167
Target Start/End: Complemental strand, 41359574 - 41359465
Alignment:
58 aacccattgccttaaggtttttgataagagtgtggtgtctcttttgcttatgtggttgttctatcctcaatgtggatgatcccccgagctcccctcagtg 157  Q
    |||||||  |||||||||||| | ||||||||||| ||||||||||||| || |||||||||| |||||||||||| | ||||||   ||||||||  ||    
41359574 aacccataaccttaaggttttgggtaagagtgtggcgtctcttttgcttgtgcggttgttctagcctcaatgtggacggtcccccagactcccctcgctg 41359475  T
158 tcccaacata 167  Q
     |||||||||    
41359474 acccaacata 41359465  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #8
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 62 - 154
Target Start/End: Complemental strand, 43346870 - 43346777
Alignment:
62 cattgccttaaggtttttgataagagtgtggtgtctcttttgcttatgtggttgttctatcctcaatgtggatgatcccccg-agctcccctca 154  Q
    ||||||||||||||||| | |||||||||||||||||| |||||| || |||||||||| |||| ||||||| | ||| ||| |||||||||||    
43346870 cattgccttaaggttttgggtaagagtgtggtgtctctcttgcttgtgcggttgttctagcctctatgtggacggtcctccgaagctcccctca 43346777  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #9
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 61 - 165
Target Start/End: Complemental strand, 42342468 - 42342364
Alignment:
61 ccattgccttaaggtttttgataagagtgtggtgtctcttttgcttatgtggttgttctatcctcaatgtggatgatcccccgagctcccctcagtgtcc 160  Q
    |||||| ||||||||||| | ||||||||||  |||||| |||||| || |||||||||| |||||||||||| | ||||||  |||||||| |||| ||    
42342468 ccattgtcttaaggttttgggtaagagtgtgacgtctctcttgcttgtgcggttgttctagcctcaatgtggacggtccccctggctccccttagtgacc 42342369  T
161 caaca 165  Q
    |||||    
42342368 caaca 42342364  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #10
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 58 - 153
Target Start/End: Complemental strand, 29644664 - 29644569
Alignment:
58 aacccattgccttaaggtttttgataagagtgtggtgtctcttttgcttatgtggttgttctatcctcaatgtggatgatcccccgagctcccctc 153  Q
    ||||||||| ||||||||||| | ||||||||||| |||||| ||||||||| ||||||| || | || ||||||||| |||||| | ||||||||    
29644664 aacccattgtcttaaggttttgggtaagagtgtggcgtctctcttgcttatgcggttgttttagcttcgatgtggatggtcccccaaactcccctc 29644569  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #11
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 58 - 137
Target Start/End: Complemental strand, 39935038 - 39934959
Alignment:
58 aacccattgccttaaggtttttgataagagtgtggtgtctcttttgcttatgtggttgttctatcctcaatgtggatgat 137  Q
    ||||||||||||||| |||||   |||||||||| ||||||| |||||| ||||||||||||| |||| |||||||||||    
39935038 aacccattgccttaaagttttgagtaagagtgtgatgtctctcttgcttgtgtggttgttctagcctcgatgtggatgat 39934959  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #12
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 58 - 131
Target Start/End: Complemental strand, 32462983 - 32462910
Alignment:
58 aacccattgccttaaggtttttgataagagtgtggtgtctcttttgcttatgtggttgttctatcctcaatgtg 131  Q
    |||||||||||||||||||||   |||||||||||||||||| |||||| || |||||||||| |||| |||||    
32462983 aacccattgccttaaggttttgagtaagagtgtggtgtctctcttgcttgtgcggttgttctagcctcgatgtg 32462910  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #13
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 58 - 142
Target Start/End: Original strand, 32589778 - 32589862
Alignment:
58 aacccattgccttaaggtttttgataagagtgtggtgtctcttttgcttatgtggttgttctatcctcaatgtggatgatccccc 142  Q
    ||||||||||||||||||||| | |||||||| | ||||||| |||||| |||||||||||||  ||| ||||||| | ||||||    
32589778 aacccattgccttaaggttttgggtaagagtgcgatgtctctcttgcttgtgtggttgttctaggctcgatgtggacggtccccc 32589862  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #14
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 62 - 150
Target Start/End: Complemental strand, 42342169 - 42342081
Alignment:
62 cattgccttaaggtttttgataagagtgtggtgtctcttttgcttatgtggttgttctatcctcaatgtggatgatcccccgagctccc 150  Q
    ||||||||||||||||| | ||||||||||| |||||| |||||| || |||||||||| |||| ||||||| | ||| |||| |||||    
42342169 cattgccttaaggttttgggtaagagtgtggcgtctctcttgcttgtgcggttgttctagcctcgatgtggacggtcctccgaactccc 42342081  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #15
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 62 - 154
Target Start/End: Original strand, 15773271 - 15773365
Alignment:
62 cattgccttaaggtttttgataagagtgtggtgtctctt--ttgcttatgtggttgttctatcctcaatgtggatgatcccccgagctcccctca 154  Q
    ||||||||||| ||||| | |||||||||| ||||||||  |||||| ||||||||||||| |||| ||||||| ||||| || | |||||||||    
15773271 cattgccttaaagttttgggtaagagtgtgatgtctcttgcttgcttgtgtggttgttctaacctcgatgtggacgatcctcctaactcccctca 15773365  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #16
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 62 - 133
Target Start/End: Original strand, 22304648 - 22304719
Alignment:
62 cattgccttaaggtttttgataagagtgtggtgtctcttttgcttatgtggttgttctatcctcaatgtgga 133  Q
    ||||||||||||||||| | |||||||||||||||||| |||||| || ||||||||||  ||| |||||||    
22304648 cattgccttaaggttttgggtaagagtgtggtgtctctcttgcttgtgcggttgttctagtctcgatgtgga 22304719  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #17
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 58 - 117
Target Start/End: Complemental strand, 54017631 - 54017572
Alignment:
58 aacccattgccttaaggtttttgataagagtgtggtgtctcttttgcttatgtggttgtt 117  Q
    ||||||||||||||||||||| | |||||||||||||||||| || |||||||| |||||    
54017631 aacccattgccttaaggttttgggtaagagtgtggtgtctctattacttatgtgattgtt 54017572  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #18
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 58 - 132
Target Start/End: Complemental strand, 41359848 - 41359774
Alignment:
58 aacccattgccttaaggtttttgataagagtgtggtgtctcttttgcttatgtggttgttctatcctcaatgtgg 132  Q
    ||||||||||||||||||||| | ||||| ||||| |||||| | |||| ||||||||||||| |||| ||||||    
41359848 aacccattgccttaaggttttgggtaagaatgtggcgtctctctcgcttgtgtggttgttctagcctcgatgtgg 41359774  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #19
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 63 - 149
Target Start/End: Original strand, 53577444 - 53577530
Alignment:
63 attgccttaaggtttttgataagagtgtggtgtctcttttgcttatgtggttgttctatcctcaatgtggatgatcccccgagctcc 149  Q
    ||||||||||||| || | |||||||||||||||||| ||||   ||||||||||||| ||||  |||||||| |||||||| ||||    
53577444 attgccttaaggtcttgggtaagagtgtggtgtctctcttgcaagtgtggttgttctagcctcggtgtggatggtcccccgaactcc 53577530  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #20
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 66 - 132
Target Start/End: Complemental strand, 54018273 - 54018207
Alignment:
66 gccttaaggtttttgataagagtgtggtgtctcttttgcttatgtggttgttctatcctcaatgtgg 132  Q
    ||||||||||||| | ||||||||||||||||||  ||||| ||||||||||||| |||| ||||||    
54018273 gccttaaggttttgggtaagagtgtggtgtctctcatgcttgtgtggttgttctagcctcgatgtgg 54018207  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #21
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 58 - 157
Target Start/End: Complemental strand, 1634397 - 1634299
Alignment:
58 aacccattgccttaaggtttttgataagagtgtggtgtctcttttgcttatgtggttgttctatcctcaatgtggatgatcccccgagctcccctcagtg 157  Q
    ||||||||| ||||||||||| | |||||||| ||| ||||| |  || || ||||||||||| |||| ||||||| | |||||| ||||||||||||||    
1634397 aacccattggcttaaggttttgggtaagagtgcggtatctctctcact-atatggttgttctagcctcgatgtggacggtccccctagctcccctcagtg 1634299  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #22
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 58 - 165
Target Start/End: Original strand, 52634750 - 52634856
Alignment:
58 aacccattgccttaaggtttttgataagagtgtggtgtctcttttgcttatgtggttgttctatcctcaatgtggatgatcccccgagctcccctcagtg 157  Q
    ||||||||||||||||||||| | ||||||||||  |||||| |||||| ||  ||||||||| |||  |||| ||   ||||||||||||||| |||||    
52634750 aacccattgccttaaggttttgggtaagagtgtgacgtctctcttgcttgtgcagttgttctagccttgatgtagactgtcccccgagctcccc-cagtg 52634848  T
158 tcccaaca 165  Q
     |||||||    
52634849 acccaaca 52634856  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #23
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 66 - 165
Target Start/End: Complemental strand, 54017891 - 54017793
Alignment:
66 gccttaaggtttttgataagagtgtggtgtctcttttgcttatgtggttgttctatcctcaatgtggatgatcccccgagctcccctcagtgtcccaaca 165  Q
    ||||||||||||| | |||||||||||||||||| || ||| ||||||||||||| | || ||||||  | ||||||  ||||||| ||||| |||||||    
54017891 gccttaaggttttgggtaagagtgtggtgtctctcttacttgtgtggttgttctagcttcgatgtgggcggtccccctggctcccc-cagtgacccaaca 54017793  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #24
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 62 - 120
Target Start/End: Original strand, 4823734 - 4823792
Alignment:
62 cattgccttaaggtttttgataagagtgtggtgtctcttttgcttatgtggttgttcta 120  Q
    |||||||||||| |||| | |||||||||||||||| ||||||||||| || |||||||    
4823734 cattgccttaagattttgggtaagagtgtggtgtcttttttgcttatgcggatgttcta 4823792  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #25
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 58 - 120
Target Start/End: Complemental strand, 12114645 - 12114583
Alignment:
58 aacccattgccttaaggtttttgataagagtgtggtgtctcttttgcttatgtggttgttcta 120  Q
    ||||||||| ||||||||||| | |||||||||||||||||| || ||| || ||||||||||    
12114645 aacccattgtcttaaggttttgggtaagagtgtggtgtctctcttacttgtgcggttgttcta 12114583  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #26
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 58 - 120
Target Start/End: Original strand, 12749244 - 12749306
Alignment:
58 aacccattgccttaaggtttttgataagagtgtggtgtctcttttgcttatgtggttgttcta 120  Q
    |||| ||||| ||||||||||||||||||||||||  || || || |||||||||||||||||    
12749244 aaccaattgcattaaggtttttgataagagtgtggactcactcttacttatgtggttgttcta 12749306  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #27
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 59 - 125
Target Start/End: Original strand, 31190085 - 31190151
Alignment:
59 acccattgccttaaggtttttgataagagtgtggtgtctcttttgcttatgtggttgttctatcctc 125  Q
    |||||| ||||||||||||| | |||||||||||||||||| |||||| |  |||||||||| ||||    
31190085 acccatagccttaaggttttgggtaagagtgtggtgtctctcttgcttgtcgggttgttctagcctc 31190151  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #28
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 58 - 167
Target Start/End: Original strand, 35946597 - 35946706
Alignment:
58 aacccattgccttaaggtttttgataagagtgtggtgtctcttttgcttatgtggttgttctatcctcaatgtggatgatccccc-gagctcccctcagt 156  Q
    ||||| ||||||||||||||| | ||| |||||||||||||| |||||| ||   |||||||| |||| ||||||| | ||||||  |||||||| ||||    
35946597 aacccgttgccttaaggttttgggtaaaagtgtggtgtctctcttgcttgtgcaattgttctagcctcgatgtggacggtcccccaaagctcccc-cagt 35946695  T
157 gtcccaacata 167  Q
    | |||||||||    
35946696 gacccaacata 35946706  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #29
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 58 - 104
Target Start/End: Original strand, 39389145 - 39389191
Alignment:
58 aacccattgccttaaggtttttgataagagtgtggtgtctcttttgc 104  Q
    ||||||||| ||||||||||| | |||||||||||||||||||||||    
39389145 aacccattgtcttaaggttttgggtaagagtgtggtgtctcttttgc 39389191  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #30
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 58 - 130
Target Start/End: Complemental strand, 22303742 - 22303670
Alignment:
58 aacccattgccttaaggtttttgataagagtgtggtgtctcttttgcttatgtggttgttctatcctcaatgt 130  Q
    ||||||||||||||||||||| | |||||||||||||| ||| || ||| || | |||||||| |||| ||||    
22303742 aacccattgccttaaggttttgggtaagagtgtggtgtttctcttacttgtgcgattgttctagcctcgatgt 22303670  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #31
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 82 - 165
Target Start/End: Complemental strand, 49336746 - 49336662
Alignment:
82 taagagtgtggtgtctct-tttgcttatgtggttgttctatcctcaatgtggatgatcccccgagctcccctcagtgtcccaaca 165  Q
    |||||||||||||||||| |||  || || ||||||||||||||||||||||||  | |||| |||| | ||||||| |||||||    
49336746 taagagtgtggtgtctctctttttttgtgcggttgttctatcctcaatgtggatcgtacccctagcttctctcagtgacccaaca 49336662  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #32
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 66 - 133
Target Start/End: Original strand, 45901797 - 45901864
Alignment:
66 gccttaaggtttttgataagagtgtggtgtctcttttgcttatgtggttgttctatcctcaatgtgga 133  Q
    ||||||| ||||||| |||||||||||||||||| || |||||  |||||||||| | || |||||||    
45901797 gccttaaagtttttggtaagagtgtggtgtctctcttacttatagggttgttctaacttcgatgtgga 45901864  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #33
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 68 - 142
Target Start/End: Complemental strand, 50612520 - 50612446
Alignment:
68 cttaaggtttttgataagagtgtggtgtctcttttgcttatgtggttgttctatcctcaatgtggatgatccccc 142  Q
    ||||||||||| | |||||||||| ||||||| ||||||  |||||||||| |||||| | ||||| | ||||||    
50612520 cttaaggttttgggtaagagtgtgatgtctctcttgcttgagtggttgttccatcctcgacgtggacggtccccc 50612446  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #34
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 62 - 99
Target Start/End: Complemental strand, 39336049 - 39336012
Alignment:
62 cattgccttaaggtttttgataagagtgtggtgtctct 99  Q
    ||||||||||||||||| | ||||||||||||||||||    
39336049 cattgccttaaggttttgggtaagagtgtggtgtctct 39336012  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #35
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 65 - 130
Target Start/End: Original strand, 39914334 - 39914399
Alignment:
65 tgccttaaggtttttgataagagtgtggtgtctcttttgcttatgtggttgttctatcctcaatgt 130  Q
    ||||||||  |||| |||||||||||||||||||| |  |||||| |||||||||| |||| ||||    
39914334 tgccttaatattttggataagagtgtggtgtctctctcacttatgcggttgttctagcctcgatgt 39914399  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #36
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 58 - 142
Target Start/End: Complemental strand, 33803335 - 33803251
Alignment:
58 aacccattgccttaaggtttttgataagagtgtggtgtctcttttgcttatgtggttgttctatcctcaatgtggatgatccccc 142  Q
    |||||||||| ||||||| || | ||||||||||| |||||  |  ||| ||||||||||||| |||| ||||||| | ||||||    
33803335 aacccattgcattaaggtattgggtaagagtgtggcgtctccctctcttgtgtggttgttctagcctcgatgtggacggtccccc 33803251  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 56; Significance: 4e-23; HSPs: 42)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 62 - 153
Target Start/End: Original strand, 3669766 - 3669857
Alignment:
62 cattgccttaaggtttttgataagagtgtggtgtctcttttgcttatgtggttgttctatcctcaatgtggatgatcccccgagctcccctc 153  Q
    ||||||||||||||||| | |||||||||||||||||| |||||| || |||||||||| |||| ||||||||| |||||| ||||||||||    
3669766 cattgccttaaggttttgggtaagagtgtggtgtctctcttgcttgtgcggttgttctagcctcgatgtggatggtccccctagctcccctc 3669857  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 62 - 140
Target Start/End: Original strand, 34834955 - 34835033
Alignment:
62 cattgccttaaggtttttgataagagtgtggtgtctcttttgcttatgtggttgttctatcctcaatgtggatgatccc 140  Q
    ||||||||||||||||| | |||||||||||||||||| |||||| ||||||||||||| |||| ||||||||||||||    
34834955 cattgccttaaggttttgggtaagagtgtggtgtctctcttgcttgtgtggttgttctagcctcgatgtggatgatccc 34835033  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 58 - 165
Target Start/End: Complemental strand, 3038373 - 3038265
Alignment:
58 aacccattgccttaaggtttttgataagagtgtggtgtctcttttgcttatgtggttgttctatcctcaatgtggatgatcccccgagctccc-ctcagt 156  Q
    ||||||||||||||||||||| | |||||||||||  ||||| |||||| ||||||||||||| |||| ||||||| | ||| |||||||||| ||||||    
3038373 aacccattgccttaaggttttgggtaagagtgtggcatctctcttgcttgtgtggttgttctagcctcgatgtggacggtcctccgagctccctctcagt 3038274  T
157 gtcccaaca 165  Q
    | |||||||    
3038273 gacccaaca 3038265  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #4
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 62 - 141
Target Start/End: Original strand, 6731974 - 6732053
Alignment:
62 cattgccttaaggtttttgataagagtgtggtgtctcttttgcttatgtggttgttctatcctcaatgtggatgatcccc 141  Q
    |||||||||||||||||   |||||||||||||||||| ||||||||| |||||||||| |||| |||||||||||||||    
6731974 cattgccttaaggttttgagtaagagtgtggtgtctctcttgcttatgcggttgttctaacctcgatgtggatgatcccc 6732053  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #5
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 58 - 165
Target Start/End: Complemental strand, 9483270 - 9483163
Alignment:
58 aacccattgccttaaggtttttgataagagtgtggtgtctcttttgcttatgtggttgttctatcctcaatgtggatgatcccccgagctcccctcagtg 157  Q
    ||||||||| ||||||||||| | ||||||||||||||||||||||||  || |||||||||| |||| ||||||| | | |||  |||||||||||||     
9483270 aacccattgtcttaaggttttgggtaagagtgtggtgtctcttttgctcgtgcggttgttctagcctcgatgtggacggttcccatagctcccctcagta 9483171  T
158 tcccaaca 165  Q
    ||||||||    
9483170 tcccaaca 9483163  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #6
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 65 - 142
Target Start/End: Complemental strand, 8919220 - 8919143
Alignment:
65 tgccttaaggtttttgataagagtgtggtgtctcttttgcttatgtggttgttctatcctcaatgtggatgatccccc 142  Q
    |||||||||||||| ||||||||||||||||||||||||||| ||||||||||||| | || ||||||| | ||||||    
8919220 tgccttaaggttttggataagagtgtggtgtctcttttgcttgtgtggttgttctagcttcgatgtggacggtccccc 8919143  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #7
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 58 - 151
Target Start/End: Original strand, 40518146 - 40518239
Alignment:
58 aacccattgccttaaggtttttgataagagtgtggtgtctcttttgcttatgtggttgttctatcctcaatgtggatgatcccccgagctcccc 151  Q
    |||||| |||||||||||||| | ||||||||||| |||||| |||||| ||||||||||||| |||  ||||||| | |||||||||||||||    
40518146 aacccaatgccttaaggttttgggtaagagtgtggcgtctctcttgcttgtgtggttgttctagccttgatgtggacggtcccccgagctcccc 40518239  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #8
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 55 - 152
Target Start/End: Complemental strand, 40579355 - 40579258
Alignment:
55 ttgaacccattgccttaaggtttttgataagagtgtggtgtctcttttgcttatgtggttgttctatcctcaatgtggatgatcccccgagctcccct 152  Q
    ||||||||||||||||| | |||| | |||||||||||||||||| |||||| || |||||||||| |||| |||||||   ||||||||||||||||    
40579355 ttgaacccattgccttaggattttgggtaagagtgtggtgtctctcttgcttgtgcggttgttctagcctcgatgtggactgtcccccgagctcccct 40579258  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #9
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 58 - 133
Target Start/End: Original strand, 30441160 - 30441235
Alignment:
58 aacccattgccttaaggtttttgataagagtgtggtgtctcttttgcttatgtggttgttctatcctcaatgtgga 133  Q
    ||||||||||||||||||||| | |||||||||||||||||| |||||| || |||||||||| |||| |||||||    
30441160 aacccattgccttaaggttttgggtaagagtgtggtgtctctcttgcttgtgcggttgttctagcctcgatgtgga 30441235  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #10
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 62 - 151
Target Start/End: Original strand, 6651573 - 6651662
Alignment:
62 cattgccttaaggtttttgataagagtgtggtgtctcttttgcttatgtggttgttctatcctcaatgtggatgatcccccgagctcccc 151  Q
    ||||||||||||||||| | |||||||||||||||||| |||||| || | |||||||| |||| ||||||||| |||||| | ||||||    
6651573 cattgccttaaggttttgggtaagagtgtggtgtctctcttgcttgtgcgattgttctaacctcgatgtggatggtccccctaactcccc 6651662  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #11
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 58 - 165
Target Start/End: Original strand, 30359346 - 30359454
Alignment:
58 aacccattgccttaaggtttttgataagagtgtggtgtctcttttgcttatgtggttgttctatcctcaatgtggat-gatcccccgagctcccctcagt 156  Q
    ||||||| ||||||||||||| | |||||||||||||||||| || ||| ||  |||||| || ||||||||||||| | |||| ||||||||||||| |    
30359346 aacccatagccttaaggttttgggtaagagtgtggtgtctctctttcttgtgatgttgttttagcctcaatgtggatggttccctcgagctcccctcaat 30359445  T
157 gtcccaaca 165  Q
    | |||||||    
30359446 gacccaaca 30359454  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #12
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 62 - 133
Target Start/End: Original strand, 5915946 - 5916017
Alignment:
62 cattgccttaaggtttttgataagagtgtggtgtctcttttgcttatgtggttgttctatcctcaatgtgga 133  Q
    ||||||||||||||||| | |||||||||||||||||| |||||| || |||||||||| |||| |||||||    
5915946 cattgccttaaggttttgggtaagagtgtggtgtctctcttgcttgtgcggttgttctagcctcgatgtgga 5916017  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #13
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 58 - 120
Target Start/End: Complemental strand, 20870656 - 20870594
Alignment:
58 aacccattgccttaaggtttttgataagagtgtggtgtctcttttgcttatgtggttgttcta 120  Q
    |||||| ||||||||| |||| |||||||||||||||||||| |||||| |||||||||||||    
20870656 aacccactgccttaagattttggataagagtgtggtgtctctcttgcttgtgtggttgttcta 20870594  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #14
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 62 - 151
Target Start/End: Complemental strand, 6876941 - 6876852
Alignment:
62 cattgccttaaggtttttgataagagtgtggtgtctcttttgcttatgtggttgttctatcctcaatgtggatgatcccccgagctcccc 151  Q
    ||||| |||| |||||| | |||||||||||||| ||| ||| || ||||||||||||| |||| ||||||| | |||||||||||||||    
6876941 cattgtcttagggttttgggtaagagtgtggtgtttctcttgtttgtgtggttgttctagcctcgatgtggacggtcccccgagctcccc 6876852  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #15
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 58 - 162
Target Start/End: Complemental strand, 9482687 - 9482583
Alignment:
58 aacccattgccttaaggtttttgataagagtgtggtgtctcttttgcttatgtggttgttctatcctcaatgtggatgatcccccgagctcccctcagtg 157  Q
    |||||||||||| ||| ||||  ||||||||||||| ||||| |||||| || |||||||||| |||| ||||||| | | |||  | ||||||||||||    
9482687 aacccattgcctaaagattttgtataagagtgtggtatctctcttgcttgtgcggttgttctagcctcgatgtggacggttcccataactcccctcagtg 9482588  T
158 tccca 162  Q
    |||||    
9482587 tccca 9482583  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #16
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 63 - 139
Target Start/End: Complemental strand, 40579584 - 40579508
Alignment:
63 attgccttaaggtttttgataagagtgtggtgtctcttttgcttatgtggttgttctatcctcaatgtggatgatcc 139  Q
    ||||| |||||||||| | |||||||||||||||||| |||||| |  ||||||||||||||| ||||||| |||||    
40579584 attgctttaaggttttaggtaagagtgtggtgtctctattgcttgtacggttgttctatcctcgatgtggacgatcc 40579508  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #17
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 58 - 133
Target Start/End: Original strand, 3670135 - 3670210
Alignment:
58 aacccattgccttaaggtttttgataagagtgtggtgtctcttttgcttatgtggttgttctatcctcaatgtgga 133  Q
    |||| ||| |||||||||||| | |||||||||||||||||| |||||| || |||||||||| |||| |||||||    
3670135 aacctatttccttaaggttttgggtaagagtgtggtgtctctcttgcttgtgcggttgttctagcctcgatgtgga 3670210  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #18
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 58 - 131
Target Start/End: Original strand, 147895 - 147968
Alignment:
58 aacccattgccttaaggtttttgataagagtgtggtgtctcttttgcttatgtggttgttctatcctcaatgtg 131  Q
    |||| |||||||||||||||| | |||||||||||||||||| || ||| ||  ||||||||| ||||||||||    
147895 aacctattgccttaaggttttgggtaagagtgtggtgtctctcttacttgtgcagttgttctagcctcaatgtg 147968  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #19
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 67 - 151
Target Start/End: Complemental strand, 1014319 - 1014234
Alignment:
67 ccttaaggtttttgataagagtgtggtgtctcttttgcttatgtggttgttctatcctcaatgtggat-gatcccccgagctcccc 151  Q
    |||||| ||||| | ||||||||||||||||||  ||||| || |||||||||| |||| |||||||| | |||||||||||||||    
1014319 ccttaaagttttgggtaagagtgtggtgtctctcctgcttgtgcggttgttctagcctcgatgtggatggttcccccgagctcccc 1014234  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #20
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 58 - 131
Target Start/End: Complemental strand, 32640615 - 32640542
Alignment:
58 aacccattgccttaaggtttttgataagagtgtggtgtctcttttgcttatgtggttgttctatcctcaatgtg 131  Q
    ||||||||||||||||||||| | ||||||||| | |||||| |||||| |||| |||||||| |||| |||||    
32640615 aacccattgccttaaggttttgggtaagagtgttgcgtctctcttgcttttgtgattgttctagcctcgatgtg 32640542  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #21
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 61 - 154
Target Start/End: Original strand, 41129066 - 41129159
Alignment:
61 ccattgccttaaggtttttgataagagtgtggtgtctcttttgcttatgtggttgttctatcctcaatgtggatgatcccccgagctcccctca 154  Q
    |||||| ||||||||||| | || ||||||||||||||| || ||| ||||||||||| | |||| ||||||| | ||||||  ||||||||||    
41129066 ccattgtcttaaggttttgggtatgagtgtggtgtctctcttacttgtgtggttgttcaaacctcgatgtggacggtcccccaggctcccctca 41129159  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #22
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 58 - 150
Target Start/End: Original strand, 40518657 - 40518749
Alignment:
58 aacccattgccttaaggtttttgataagagtgtggtgtctcttttgcttatgtggttgttctatcctcaatgtggatgatcccccgagctccc 150  Q
    |||||| || ||||||||||| | ||||||||||  ||| || |||||| ||||||||||||| |||||||||||| | ||| | ||||||||    
40518657 aacccaatgacttaaggttttgggtaagagtgtgacgtcactcttgcttgtgtggttgttctagcctcaatgtggacggtcctctgagctccc 40518749  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #23
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 58 - 129
Target Start/End: Complemental strand, 70357 - 70286
Alignment:
58 aacccattgccttaaggtttttgataagagtgtggtgtctcttttgcttatgtggttgttctatcctcaatg 129  Q
    |||||| |||||||||||||| | ||||||||||  |||| | |||||| ||||||||||||| ||||||||    
70357 aacccactgccttaaggttttaggtaagagtgtgacgtctatcttgcttgtgtggttgttctaacctcaatg 70286  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #24
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 62 - 165
Target Start/End: Original strand, 9309434 - 9309535
Alignment:
62 cattgccttaaggtttttgataagagtgtggtgtctcttttgcttatgtggttgttctatcctcaatgtggatgatcccccgagctcccctcagtgtccc 161  Q
    |||||||||||||| |  | |||||||||||||||||| |   | |||||||||||||| |||| ||||||| | ||||||||||||||| ||||| |||    
9309434 cattgccttaaggtgtcgggtaagagtgtggtgtctctctcagt-atgtggttgttctagcctcgatgtggacggtcccccgagctcccc-cagtgaccc 9309531  T
162 aaca 165  Q
    ||||    
9309532 aaca 9309535  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #25
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 62 - 129
Target Start/End: Complemental strand, 33113446 - 33113379
Alignment:
62 cattgccttaaggtttttgataagagtgtggtgtctcttttgcttatgtggttgttctatcctcaatg 129  Q
    |||||||||||| |||| | |||||||||||||||||| |||||  |||||||||||||  |||||||    
33113446 cattgccttaagattttgggtaagagtgtggtgtctctcttgctagtgtggttgttctaggctcaatg 33113379  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #26
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 58 - 135
Target Start/End: Complemental strand, 1013954 - 1013877
Alignment:
58 aacccattgccttaaggtttttgataagagtgtggtgtctcttttgcttatgtggttgttctatcctcaatgtggatg 135  Q
    ||||||||||||||  |||||   |||||||||| |||||||||| ||| || |||||||||| |||| |||||||||    
1013954 aacccattgccttagagttttgagtaagagtgtgttgtctcttttacttgtgcggttgttctagcctcgatgtggatg 1013877  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #27
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 62 - 154
Target Start/End: Complemental strand, 18372073 - 18371980
Alignment:
62 cattgccttaaggtttttgataagagtgtggtgtctcttttgcttatgtggttgttctatcctcaatgtgga-tgatcccccgagctcccctca 154  Q
    |||||| |||||||||| | |||||||||||||| ||| | |||| || ||||| |||| |||||||||| |  | ||||||||||||||||||    
18372073 cattgctttaaggttttgggtaagagtgtggtgtttctctcgcttgtgcggttgctctagcctcaatgtgaacggttcccccgagctcccctca 18371980  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #28
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 62 - 151
Target Start/End: Original strand, 34835288 - 34835377
Alignment:
62 cattgccttaaggtttttgataagagtgtggtgtctcttttgcttatgtggttgttctatcctcaatgtggatgatcccccgagctcccc 151  Q
    ||||||||||| ||||| | ||||||||||||||| || |||||| ||||||| ||||| |||| |||| || | ||||||  |||||||    
34835288 cattgccttaaagttttgggtaagagtgtggtgtcactcttgcttgtgtggttattctagcctcgatgtagacggtccccctggctcccc 34835377  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #29
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 62 - 151
Target Start/End: Original strand, 34835554 - 34835643
Alignment:
62 cattgccttaaggtttttgataagagtgtggtgtctcttttgcttatgtggttgttctatcctcaatgtggatgatcccccgagctcccc 151  Q
    ||||||||||| ||||| | ||||||||||||||| || |||||| ||||||| ||||| |||| |||| || | ||||||  |||||||    
34835554 cattgccttaaagttttgggtaagagtgtggtgtcactcttgcttgtgtggttattctagcctcgatgtagacggtccccctggctcccc 34835643  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #30
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 62 - 151
Target Start/End: Original strand, 34835820 - 34835909
Alignment:
62 cattgccttaaggtttttgataagagtgtggtgtctcttttgcttatgtggttgttctatcctcaatgtggatgatcccccgagctcccc 151  Q
    ||||||||||| ||||| | ||||||||||||||| || |||||| ||||||| ||||| |||| |||| || | ||||||  |||||||    
34835820 cattgccttaaagttttgggtaagagtgtggtgtcactcttgcttgtgtggttattctagcctcgatgtagacggtccccctggctcccc 34835909  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #31
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 69 - 154
Target Start/End: Complemental strand, 37544562 - 37544478
Alignment:
69 ttaaggtttttgataagagtgtggtgtctcttttgcttatgtggttgttctatcctcaatgtggatgatcccccgagctcccctca 154  Q
    |||||||||| | |||||||||||||||| | || ||| || |||||||||| |||| ||||||| ||| ||||||| ||||||||    
37544562 ttaaggttttgggtaagagtgtggtgtctttcttacttgtgcggttgttctagcctcgatgtggacgat-ccccgagttcccctca 37544478  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #32
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 85 - 150
Target Start/End: Complemental strand, 43274691 - 43274626
Alignment:
85 gagtgtggtgtctcttttgcttatgtggttgttctatcctcaatgtggatgatcccccgagctccc 150  Q
    ||||||||||||||| || |||||| |||||||| | |||| ||||||| | ||||||||||||||    
43274691 gagtgtggtgtctctcttacttatggggttgttccagcctcgatgtggacggtcccccgagctccc 43274626  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #33
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 68 - 132
Target Start/End: Original strand, 12283957 - 12284021
Alignment:
68 cttaaggtttttgataagagtgtggtgtctcttttgcttatgtggttgttctatcctcaatgtgg 132  Q
    ||||||||||| ||||||||||| |||||||| |  ||| ||||||||||||| |||| ||||||    
12283957 cttaaggttttggataagagtgtagtgtctctctcacttgtgtggttgttctagcctctatgtgg 12284021  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #34
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 62 - 142
Target Start/End: Original strand, 45122703 - 45122783
Alignment:
62 cattgccttaaggtttttgataagagtgtggtgtctcttttgcttatgtggttgttctatcctcaatgtggatgatccccc 142  Q
    ||||| ||||||||||| | || |||||||| |||||| |||||| ||||||||||| | |||| ||||||| | ||||||    
45122703 cattgtcttaaggttttgggtatgagtgtggcgtctctcttgcttgtgtggttgttcaagcctcgatgtggaaggtccccc 45122783  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #35
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 58 - 133
Target Start/End: Original strand, 9507857 - 9507932
Alignment:
58 aacccattgccttaaggtttttgataagagtgtggtgtctcttttgcttatgtggttgttctatcctcaatgtgga 133  Q
    |||||||| |||||||||||| | ||||||||||| |||||| |  ||||| ||||||||| | |||| |||||||    
9507857 aacccattaccttaaggttttgggtaagagtgtggcgtctctatctcttatatggttgttcaagcctcgatgtgga 9507932  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #36
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 58 - 121
Target Start/End: Original strand, 9609160 - 9609223
Alignment:
58 aacccattgccttaaggtttttgataagagtgtggtgtctcttttgcttatgtggttgttctat 121  Q
    ||||||| ||||||| ||||| | ||||||||||| |||||| |||||  ||||||||||||||    
9609160 aacccatcgccttaatgttttcggtaagagtgtggcgtctctcttgctagtgtggttgttctat 9609223  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #37
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 58 - 133
Target Start/End: Original strand, 30359684 - 30359759
Alignment:
58 aacccattgccttaaggtttttgataagagtgtggtgtctcttttgcttatgtggttgttctatcctcaatgtgga 133  Q
    |||||||  ||||||| |||| | |||||||||||||||||| || |||||| |||||||||| | || |||||||    
30359684 aacccataaccttaagattttgggtaagagtgtggtgtctctcttacttatgcggttgttctaacttcgatgtgga 30359759  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #38
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 62 - 153
Target Start/End: Complemental strand, 45121989 - 45121898
Alignment:
62 cattgccttaaggtttttgataagagtgtggtgtctcttttgcttatgtggttgttctatcctcaatgtggatgatcccccgagctcccctc 153  Q
    |||||||||||| |||| | ||| ||||||| ||||||||||||  ||||||| ||| | |||| ||||||| | ||||||  |||||||||    
45121989 cattgccttaagattttgggtaacagtgtggcgtctcttttgctcgtgtggttattcaagcctcgatgtggaaggtcccccaggctcccctc 45121898  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #39
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 68 - 131
Target Start/End: Complemental strand, 45122130 - 45122067
Alignment:
68 cttaaggtttttgataagagtgtggtgtctcttttgcttatgtggttgttctatcctcaatgtg 131  Q
    ||||||||||| | |||||||||||||||||| || ||| || |||||||||| |||| |||||    
45122130 cttaaggttttgggtaagagtgtggtgtctctcttacttgtggggttgttctagcctcgatgtg 45122067  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #40
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 108 - 165
Target Start/End: Complemental strand, 3038002 - 3037944
Alignment:
108 tgtggttgttctatcctcaatgtggatgatcccccgagct-cccctcagtgtcccaaca 165  Q
    ||||||||||||| |||| ||||||| | ||||||||||| |||||||||| |||||||    
3038002 tgtggttgttctagcctcgatgtggacggtcccccgagctccccctcagtgacccaaca 3037944  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #41
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 58 - 151
Target Start/End: Original strand, 9309054 - 9309149
Alignment:
58 aacccattgccttaaggtttttgataag---agtgtggtgtctcttttgcttatgtggttgttctatcctcaatgtggatgatcccccgagctcccc 151  Q
    |||||||||||| |||||||| |  |||   |||||||||||||| |  | ||||||||||||||| |||| ||||||| | |||||||||||||||    
9309054 aacccattgcctaaaggttttgggcaagagtagtgtggtgtctctctcac-tatgtggttgttctagcctcgatgtggacggtcccccgagctcccc 9309149  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #42
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 58 - 142
Target Start/End: Original strand, 32305552 - 32305636
Alignment:
58 aacccattgccttaaggtttttgataagagtgtggtgtctcttttgcttatgtggttgttctatcctcaatgtggatgatccccc 142  Q
    |||||||| ||||||| |||| ||||||||||||| |||| | || ||||||  ||||||||| |||  ||||||| | ||||||    
32305552 aacccattaccttaagattttggataagagtgtggcgtctttattacttatgcagttgttctaaccttgatgtggacggtccccc 32305636  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 56; Significance: 4e-23; HSPs: 48)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 60 - 147
Target Start/End: Complemental strand, 54343087 - 54343000
Alignment:
60 cccattgccttaaggtttttgataagagtgtggtgtctcttttgcttatgtggttgttctatcctcaatgtggatgatcccccgagct 147  Q
    ||||||||||||||||||| | |||||||||||||||||| ||||||  |||||||||||| |||| ||||||||| |||||||||||    
54343087 cccattgccttaaggttttgggtaagagtgtggtgtctctcttgcttgagtggttgttctagcctcgatgtggatggtcccccgagct 54343000  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 58 - 151
Target Start/End: Complemental strand, 54017676 - 54017583
Alignment:
58 aacccattgccttaaggtttttgataagagtgtggtgtctcttttgcttatgtggttgttctatcctcaatgtggatgatcccccgagctcccc 151  Q
    ||||||||||||||||||||| | |||||||||| ||||||| |||||||||||||||||||| |||| ||||||| | || ||| ||||||||    
54017676 aacccattgccttaaggttttaggtaagagtgtgatgtctctcttgcttatgtggttgttctagcctcgatgtggacggtctccctagctcccc 54017583  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 62 - 154
Target Start/End: Complemental strand, 39792937 - 39792845
Alignment:
62 cattgccttaaggtttttgataagagtgtggtgtctcttttgcttatgtggttgttctatcctcaatgtggatgatcccccgagctcccctca 154  Q
    ||||||||||||||||| | |||||||||||||||||| |||||| ||||||||||||| |||| ||||||| | ||| | ||||||||||||    
39792937 cattgccttaaggttttgggtaagagtgtggtgtctctcttgcttgtgtggttgttctagcctcgatgtggacggtcctctgagctcccctca 39792845  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 58 - 133
Target Start/End: Original strand, 25483411 - 25483486
Alignment:
58 aacccattgccttaaggtttttgataagagtgtggtgtctcttttgcttatgtggttgttctatcctcaatgtgga 133  Q
    ||||||||||||||||||||| | |||||||||||||||||| |||||| ||||||||||||| |||| |||||||    
25483411 aacccattgccttaaggttttgggtaagagtgtggtgtctctcttgcttgtgtggttgttctagcctcgatgtgga 25483486  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #5
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 62 - 164
Target Start/End: Original strand, 36629316 - 36629418
Alignment:
62 cattgccttaaggtttttgataagagtgtggtgtctcttttgcttatgtggttgttctatcctcaatgtggatgatcccccgagctcccctcagtgtccc 161  Q
    ||||||||||||||||| | |||||||||||||||||| |||||| ||||||||||||| |||| ||||||| | |||| |  |||||||||| || |||    
36629316 cattgccttaaggttttgggtaagagtgtggtgtctctcttgcttgtgtggttgttctagcctcgatgtggacggtcccacatgctcccctcaatgaccc 36629415  T
162 aac 164  Q
    |||    
36629416 aac 36629418  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #6
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 69 - 154
Target Start/End: Original strand, 39404104 - 39404189
Alignment:
69 ttaaggtttttgataagagtgtggtgtctcttttgcttatgtggttgttctatcctcaatgtggatgatcccccgagctcccctca 154  Q
    |||||||||| | ||||||||||| |||||| |||||| ||||||||||||| |||| ||||||| | ||||||||||||||||||    
39404104 ttaaggttttgggtaagagtgtggcgtctctcttgcttgtgtggttgttctagcctcgatgtggacggtcccccgagctcccctca 39404189  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #7
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 58 - 133
Target Start/End: Complemental strand, 1731728 - 1731653
Alignment:
58 aacccattgccttaaggtttttgataagagtgtggtgtctcttttgcttatgtggttgttctatcctcaatgtgga 133  Q
    |||| |||||||||||||||| | |||||||||||||| ||| |||||| ||||||||||||| ||||||||||||    
1731728 aaccaattgccttaaggttttgggtaagagtgtggtgtttctcttgcttgtgtggttgttctagcctcaatgtgga 1731653  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #8
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 58 - 141
Target Start/End: Original strand, 49302981 - 49303064
Alignment:
58 aacccattgccttaaggtttttgataagagtgtggtgtctcttttgcttatgtggttgttctatcctcaatgtggatgatcccc 141  Q
    ||||||||||||||||||||| | |||||||||||||| ||| || |||||| | ||||||||||||| ||||||| |||||||    
49302981 aacccattgccttaaggttttgggtaagagtgtggtgtatctcttacttatgcgattgttctatcctcgatgtggacgatcccc 49303064  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #9
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 58 - 165
Target Start/End: Original strand, 54936271 - 54936376
Alignment:
58 aacccattgccttaaggtttttgataagagtgtggtgtctcttttgcttatgtggttgttctatcctcaatgtggatgatcccccgagctcccctcagtg 157  Q
    ||||||||||||||||||||| | |||||||||||||||||| |  | ||||||||||||||| |||| |||||||   ||||||||||||||| |||||    
54936271 aacccattgccttaaggttttgggtaagagtgtggtgtctctctcac-tatgtggttgttctagcctcgatgtggacagtcccccgagctcccc-cagtg 54936368  T
158 tcccaaca 165  Q
     |||||||    
54936369 acccaaca 54936376  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #10
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 62 - 132
Target Start/End: Original strand, 54108616 - 54108686
Alignment:
62 cattgccttaaggtttttgataagagtgtggtgtctcttttgcttatgtggttgttctatcctcaatgtgg 132  Q
    ||||||||||||||||| | |||||||||||||||| | |||||| ||||||||||||| |||||||||||    
54108616 cattgccttaaggttttggctaagagtgtggtgtctatcttgcttgtgtggttgttctagcctcaatgtgg 54108686  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #11
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 58 - 163
Target Start/End: Complemental strand, 50630836 - 50630731
Alignment:
58 aacccattgccttaaggtttttgataagagtgtggtgtctcttttgcttatgtggttgttctatcctcaatgtggatgatcccccgagctcccctcagtg 157  Q
    ||||||||||||||||||||| | |||||||||||||||||| |||||| || ||||||| || |||| ||||||  | ||| || ||||||||||| ||    
50630836 aacccattgccttaaggttttgggtaagagtgtggtgtctctcttgcttgtgcggttgttttagcctcgatgtgggcggtccgcctagctcccctcactg 50630737  T
158 tcccaa 163  Q
     |||||    
50630736 acccaa 50630731  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #12
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 62 - 165
Target Start/End: Complemental strand, 22028446 - 22028342
Alignment:
62 cattgccttaaggtttttgataagagtgtggtgtctcttttgcttatgtggttgttctatcctcaatgtggatgatccccc-gagctcccctcagtgtcc 160  Q
    ||||| ||||| ||||| | |||||||||||||||||| |||||| || |||||||||| |||||||||||| | ||||||  ||||||||||| || ||    
22028446 cattgtcttaatgttttgggtaagagtgtggtgtctctcttgcttgtgaggttgttctagcctcaatgtggacggtcccccaaagctcccctcactgacc 22028347  T
161 caaca 165  Q
    |||||    
22028346 caaca 22028342  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #13
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 62 - 142
Target Start/End: Complemental strand, 23817758 - 23817678
Alignment:
62 cattgccttaaggtttttgataagagtgtggtgtctcttttgcttatgtggttgttctatcctcaatgtggatgatccccc 142  Q
    ||||||||||||||||| | |||||||||||||||||| |||||  ||||||||||||| |||| ||||||| | ||||||    
23817758 cattgccttaaggttttgggtaagagtgtggtgtctctcttgctagtgtggttgttctagcctcgatgtggacggtccccc 23817678  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #14
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 62 - 154
Target Start/End: Original strand, 43827519 - 43827610
Alignment:
62 cattgccttaaggtttttgataagagtgtggtgtctcttttgcttatgtggttgttctatcctcaatgtggatgatcccccgagctcccctca 154  Q
    ||||||||||||||||  |||||||||||||||||||| || ||| || |||||||||| |||| ||||||| | ||||||||||| ||||||    
43827519 cattgccttaaggtttg-gataagagtgtggtgtctctcttacttgtgcggttgttctaacctcgatgtggacggtcccccgagcttccctca 43827610  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #15
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 58 - 165
Target Start/End: Original strand, 3340882 - 3340988
Alignment:
58 aacccattgccttaaggtttttgataagagtgtggtgtctcttttgcttatgtggttgttctatcctcaatgtggatgatcccccgagctcccctcagtg 157  Q
    |||||| |||||||||||||| | |||||||||||||||| | |||||| || |||||||||| |||| ||||||| | || || ||||||||| |||||    
3340882 aacccactgccttaaggttttgggtaagagtgtggtgtctttcttgcttgtggggttgttctagcctcgatgtggacggtctcctgagctcccc-cagtg 3340980  T
158 tcccaaca 165  Q
     |||||||    
3340981 acccaaca 3340988  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #16
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 66 - 153
Target Start/End: Original strand, 10246002 - 10246089
Alignment:
66 gccttaaggtttttgataagagtgtggtgtctcttttgcttatgtggttgttctatcctcaatgtggatgatcccccgagctcccctc 153  Q
    ||||||||||||| | |||||||||||||||||  |||||| | ||||||||||| |||| ||||||| | |||||| ||||||||||    
10246002 gccttaaggttttgggtaagagtgtggtgtctcccttgcttgtctggttgttctagcctcgatgtggacgctcccccaagctcccctc 10246089  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #17
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 58 - 165
Target Start/End: Original strand, 41370432 - 41370538
Alignment:
58 aacccattgccttaaggtttttgataagagtgtggtgtctcttttgcttatgtggttgttctatcctcaatgtggatgatcccccgagctcccctcagtg 157  Q
    ||||||||||||||| ||||| | ||||||||| |||||||| ||||||  |||||||||||| |||| ||||||| | |||||||| || ||| |||||    
41370432 aacccattgccttaaagttttgggtaagagtgtagtgtctctcttgcttgagtggttgttctagcctcgatgtggacggtcccccgaacttccc-cagtg 41370530  T
158 tcccaaca 165  Q
     |||||||    
41370531 acccaaca 41370538  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #18
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 67 - 154
Target Start/End: Original strand, 44620743 - 44620830
Alignment:
67 ccttaaggtttttgataagagtgtggtgtctcttttgcttatgtggttgttctatcctcaatgtggatgatcccccgagctcccctca 154  Q
    |||||||||||| | |||||||||||| ||||| |||||| || ||||||| ||||||| ||||||| | |||||| |||||||||||    
44620743 ccttaaggttttgggtaagagtgtggtttctctcttgcttgtgcggttgttatatcctcgatgtggacggtcccccaagctcccctca 44620830  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #19
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 58 - 147
Target Start/End: Complemental strand, 18932830 - 18932741
Alignment:
58 aacccattgccttaaggtttttgataagagtgtggtgtctcttttgcttatgtggttgttctatcctcaatgtggatgatcccccgagct 147  Q
    ||||||||||||||||||||| | |||||||||||||||||| || |||  ||||||||| || |||| ||||| | | |||||||||||    
18932830 aacccattgccttaaggttttaggtaagagtgtggtgtctctcttacttgagtggttgttatagcctcgatgtgtacggtcccccgagct 18932741  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #20
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 61 - 130
Target Start/End: Complemental strand, 50788072 - 50788003
Alignment:
61 ccattgccttaaggtttttgataagagtgtggtgtctcttttgcttatgtggttgttctatcctcaatgt 130  Q
    |||||||||||||||||| |||||||||||||||||||| | |||||| |||||| |||| | |||||||    
50788072 ccattgccttaaggttttagataagagtgtggtgtctctgtcgcttatttggttgctctaacttcaatgt 50788003  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #21
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 61 - 153
Target Start/End: Complemental strand, 36608739 - 36608647
Alignment:
61 ccattgccttaaggtttttgataagagtgtggtgtctcttttgcttatgtggttgttctatcctcaatgtggatgatcccccgagctcccctc 153  Q
    |||||| ||||||||||| | |||||||||||||||||| |  ||  ||||||||||||| |||| ||||||| | |||||| ||||||||||    
36608739 ccattgtcttaaggttttgggtaagagtgtggtgtctctctcactagtgtggttgttctagcctcgatgtggacggtcccccaagctcccctc 36608647  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #22
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 58 - 133
Target Start/End: Original strand, 44620428 - 44620503
Alignment:
58 aacccattgccttaaggtttttgataagagtgtggtgtctcttttgcttatgtggttgttctatcctcaatgtgga 133  Q
    ||||||||||||||||||||| | |||||||||| ||| ||| |||||| ||||||||||||| |||  |||||||    
44620428 aacccattgccttaaggttttgggtaagagtgtgatgtttctcttgcttgtgtggttgttctaaccttgatgtgga 44620503  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #23
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 58 - 151
Target Start/End: Original strand, 18879881 - 18879974
Alignment:
58 aacccattgccttaaggtttttgataagagtgtggtgtctcttttgcttatgtggttgttctatcctcaatgtggatgatcccccgagctcccc 151  Q
    |||| ||| |||||||||||| | ||||||||||  |||||||||| || ||||||||||||| | || ||||||| | ||| |||||||||||    
18879881 aacctatttccttaaggttttgggtaagagtgtgacgtctcttttggttgtgtggttgttctagcttcgatgtggacggtcctccgagctcccc 18879974  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #24
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 58 - 131
Target Start/End: Original strand, 50459796 - 50459869
Alignment:
58 aacccattgccttaaggtttttgataagagtgtggtgtctcttttgcttatgtggttgttctatcctcaatgtg 131  Q
    ||||||||  ||||||||||| | |||||| ||||||||||| |||||| ||||||||||||| |||| |||||    
50459796 aacccattatcttaaggttttaggtaagagcgtggtgtctctcttgcttgtgtggttgttctagcctcgatgtg 50459869  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #25
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 58 - 142
Target Start/End: Complemental strand, 22183345 - 22183261
Alignment:
58 aacccattgccttaaggtttttgataagagtgtggtgtctcttttgcttatgtggttgttctatcctcaatgtggatgatccccc 142  Q
    ||||||||||||||||||||| ||||||||||||| |||||| |  ||| |  |||||||||| |||| ||||||| | ||||||    
22183345 aacccattgccttaaggttttggataagagtgtggcgtctctctcacttgtacggttgttctagcctcgatgtggacggtccccc 22183261  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #26
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 61 - 165
Target Start/End: Original strand, 50002504 - 50002608
Alignment:
61 ccattgccttaaggtttttgataagagtgtggtgtctcttttgcttatgtggttgttctatcctcaatgtggatgatcccccgagctcccctcagtgtcc 160  Q
    |||||| ||||||||||| | |||||||||||||||||| || ||| || |||||||||| |||| ||||||  | |||||||| |  |||| |||| ||    
50002504 ccattgtcttaaggttttgggtaagagtgtggtgtctctcttacttgtgcggttgttctagcctcgatgtgggcggtcccccgaaccaccctaagtgacc 50002603  T
161 caaca 165  Q
    |||||    
50002604 caaca 50002608  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #27
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 58 - 150
Target Start/End: Complemental strand, 55933205 - 55933113
Alignment:
58 aacccattgccttaaggtttttgataagagtgtggtgtctcttttgcttatgtggttgttctatcctcaatgtggatgatcccccgagctccc 150  Q
    ||||||||||||||| ||||| | |||||||||||||||||| || ||| |   ||||||||| |||| ||||||| | |||||| |||||||    
55933205 aacccattgccttaaagttttgggtaagagtgtggtgtctctcttacttgtacagttgttctagcctcgatgtggacggtcccccaagctccc 55933113  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #28
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 62 - 133
Target Start/End: Complemental strand, 32941200 - 32941129
Alignment:
62 cattgccttaaggtttttgataagagtgtggtgtctcttttgcttatgtggttgttctatcctcaatgtgga 133  Q
    ||||||||||||||||| | ||||||||||  |||||| |||||| || |||||||||| |||| |||||||    
32941200 cattgccttaaggttttgggtaagagtgtgacgtctctcttgcttgtgcggttgttctagcctcgatgtgga 32941129  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #29
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 69 - 140
Target Start/End: Complemental strand, 45489402 - 45489331
Alignment:
69 ttaaggtttttgataagagtgtggtgtctcttttgcttatgtggttgttctatcctcaatgtggatgatccc 140  Q
    ||||| |||||| |||||||||| |||||||||||||  |||| |||||||| |||| ||||||||| ||||    
45489402 ttaagatttttggtaagagtgtgatgtctcttttgctagtgtgattgttctagcctcgatgtggatggtccc 45489331  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #30
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 63 - 117
Target Start/End: Complemental strand, 22028037 - 22027983
Alignment:
63 attgccttaaggtttttgataagagtgtggtgtctcttttgcttatgtggttgtt 117  Q
    |||||||||||||||| | ||||| |||||||||||| | |||||||||||||||    
22028037 attgccttaaggttttgggtaagaatgtggtgtctctctcgcttatgtggttgtt 22027983  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #31
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 58 - 131
Target Start/End: Original strand, 52884770 - 52884844
Alignment:
58 aacccattgccttaaggtttttga-taagagtgtggtgtctcttttgcttatgtggttgttctatcctcaatgtg 131  Q
    ||||||||||||||||||||| |  |||||||||||||||||| |||||| || ||||| |||| |||| |||||    
52884770 aacccattgccttaaggttttggggtaagagtgtggtgtctctcttgcttgtgcggttgatctagcctcgatgtg 52884844  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #32
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 58 - 120
Target Start/End: Original strand, 54108988 - 54109049
Alignment:
58 aacccattgccttaaggtttttgataagagtgtggtgtctcttttgcttatgtggttgttcta 120  Q
    |||||||||||||||| |||| | |||||||||||||||||| |||||| || ||||||||||    
54108988 aacccattgccttaag-ttttgggtaagagtgtggtgtctctcttgcttgtgcggttgttcta 54109049  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #33
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 66 - 154
Target Start/End: Original strand, 2740783 - 2740869
Alignment:
66 gccttaaggtttttgataagagtgtggtgtctcttttgcttatgtggttgttctatcctcaatgtggatgatcccccgagctcccctca 154  Q
    |||||||||||||   ||||||||||| |||||| |  |||  |||||||||||| |||| || |||||| ||||||||||||||||||    
2740783 gccttaaggttttacgtaagagtgtggcgtctctctcactt--gtggttgttctagcctcgatatggatggtcccccgagctcccctca 2740869  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #34
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 66 - 131
Target Start/End: Original strand, 39404481 - 39404546
Alignment:
66 gccttaaggtttttgataagagtgtggtgtctcttttgcttatgtggttgttctatcctcaatgtg 131  Q
    ||||||||||||| |  |||| |||||||||||| |||||| ||||||||||||| |||| |||||    
39404481 gccttaaggttttgggcaagaatgtggtgtctctcttgcttgtgtggttgttctagcctcgatgtg 39404546  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #35
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 58 - 150
Target Start/End: Complemental strand, 49076912 - 49076820
Alignment:
58 aacccattgccttaaggtttttgataagagtgtggtgtctcttttgcttatgtggttgttctatcctcaatgtggatgatcccccgagctccc 150  Q
    |||||||  |||||||||||| | | |||||||||||||| | |||||| || |||||||||| |||| |||||||   ||||| ||||||||    
49076912 aacccataaccttaaggttttgggttagagtgtggtgtctttcttgcttgtgcggttgttctagcctcgatgtggactgtcccctgagctccc 49076820  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #36
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 66 - 133
Target Start/End: Original strand, 20825919 - 20825986
Alignment:
66 gccttaaggtttttgataagagtgtggtgtctcttttgcttatgtggttgttctatcctcaatgtgga 133  Q
    ||||||||||||| | |||||||||||||| ||| || |||||| |||||||||| |||  |||||||    
20825919 gccttaaggttttgggtaagagtgtggtgtttctcttccttatgcggttgttctagccttgatgtgga 20825986  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #37
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 62 - 133
Target Start/End: Original strand, 44621081 - 44621152
Alignment:
62 cattgccttaaggtttttgataagagtgtggtgtctcttttgcttatgtggttgttctatcctcaatgtgga 133  Q
    ||||| ||||||||||| | |||||||||||||| ||| |||||| || |||| ||||| |||| |||||||    
44621081 cattgtcttaaggttttgggtaagagtgtggtgtttctcttgcttgtgcggttattctagcctcgatgtgga 44621152  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #38
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 61 - 144
Target Start/End: Complemental strand, 48111776 - 48111693
Alignment:
61 ccattgccttaaggtttttgataagagtgtggtgtctcttttgcttatgtggttgttctatcctcaatgtggatgatcccccga 144  Q
    ||||| |||||||||||| | || ||||||||||||||| |  |  |||||||| ||||| |||||||||||| | ||||||||    
48111776 ccattaccttaaggttttaggtatgagtgtggtgtctctctcacaaatgtggtttttctaacctcaatgtggacggtcccccga 48111693  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #39
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 58 - 120
Target Start/End: Complemental strand, 4955398 - 4955336
Alignment:
58 aacccattgccttaaggtttttgataagagtgtggtgtctcttttgcttatgtggttgttcta 120  Q
    ||||||||||||||||||||| | ||||||||||| |||||| || ||| || ||||| ||||    
4955398 aacccattgccttaaggttttgggtaagagtgtggcgtctctcttacttgtgcggttgctcta 4955336  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #40
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 63 - 125
Target Start/End: Original strand, 19504776 - 19504838
Alignment:
63 attgccttaaggtttttgataagagtgtggtgtctcttttgcttatgtggttgttctatcctc 125  Q
    |||||||||| ||||| | ||||||||||| |||| | |||||| ||||||||||||| ||||    
19504776 attgccttaaagttttgggtaagagtgtggcgtctatcttgcttgtgtggttgttctagcctc 19504838  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #41
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 62 - 120
Target Start/End: Complemental strand, 34646726 - 34646668
Alignment:
62 cattgccttaaggtttttgataagagtgtggtgtctcttttgcttatgtggttgttcta 120  Q
    ||||||||||||||||| | |||||||||||||||||| | |  | |||||||||||||    
34646726 cattgccttaaggttttgggtaagagtgtggtgtctctctggtctgtgtggttgttcta 34646668  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #42
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 62 - 112
Target Start/End: Original strand, 45496884 - 45496934
Alignment:
62 cattgccttaaggtttttgataagagtgtggtgtctcttttgcttatgtgg 112  Q
    ||||| ||||||||||| | |||||||||||||||||| |||||| |||||    
45496884 cattgtcttaaggttttgggtaagagtgtggtgtctctcttgcttgtgtgg 45496934  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #43
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 58 - 120
Target Start/End: Original strand, 49880235 - 49880296
Alignment:
58 aacccattgccttaaggtttttgataagagtgtggtgtctcttttgcttatgtggttgttcta 120  Q
    |||||| |||||||||||||| | |||||| ||||||||||| ||| |||||| |||||||||    
49880235 aacccactgccttaaggttttgggtaagagcgtggtgtctctcttgtttatgt-gttgttcta 49880296  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #44
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 58 - 99
Target Start/End: Original strand, 10396491 - 10396532
Alignment:
58 aacccattgccttaaggtttttgataagagtgtggtgtctct 99  Q
    |||||||||||||| |||||| |||||||||||||| |||||    
10396491 aacccattgccttagggttttggataagagtgtggtctctct 10396532  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #45
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 58 - 99
Target Start/End: Original strand, 11197301 - 11197342
Alignment:
58 aacccattgccttaaggtttttgataagagtgtggtgtctct 99  Q
    |||||||||||||| |||||| | ||||||||||||||||||    
11197301 aacccattgccttagggttttgggtaagagtgtggtgtctct 11197342  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #46
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 67 - 120
Target Start/End: Original strand, 40067128 - 40067181
Alignment:
67 ccttaaggtttttgataagagtgtggtgtctcttttgcttatgtggttgttcta 120  Q
    ||||||| |||| | ||| |||||| ||||||| ||||||||||||||||||||    
40067128 ccttaagattttgggtaaaagtgtgatgtctctcttgcttatgtggttgttcta 40067181  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #47
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 82 - 151
Target Start/End: Original strand, 43174240 - 43174309
Alignment:
82 taagagtgtggtgtctcttttgcttatgtggttgttctatcctcaatgtggatgatcccccgagctcccc 151  Q
    |||||||||||||||||| |  ||| ||||||||||| | |||  ||||||| | |||||||||||||||    
43174240 taagagtgtggtgtctctctcacttgtgtggttgttcaagccttgatgtggacggtcccccgagctcccc 43174309  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #48
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 62 - 151
Target Start/End: Original strand, 31691231 - 31691322
Alignment:
62 cattgccttaaggtttttgataagagtgtggtgtc--tcttttgcttatgtggttgttctatcctcaatgtggatgatcccccgagctcccc 151  Q
    ||||||||||||||||| | ||||||||||| |||  ||| |||||| |  | |||||||| |||| ||||||| |||||  ||||||||||    
31691231 cattgccttaaggttttgggtaagagtgtggcgtctatctcttgcttgtacgattgttctagcctcgatgtggacgatccttcgagctcccc 31691322  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0391 (Bit Score: 52; Significance: 1e-20; HSPs: 2)
Name: scaffold0391
Description:

Target: scaffold0391; HSP #1
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 58 - 165
Target Start/End: Complemental strand, 1189 - 1083
Alignment:
58 aacccattgccttaaggtttttgataagagtgtggtgtctcttttgcttatgtggttgttctatcctcaatgtggatgatcccccgagctcccctcagtg 157  Q
    ||||||||||||||||||||| | ||||||| |||||||||| ||| |||||||||||||||| |||| ||||||| | | |||| |||||||| |||||    
1189 aacccattgccttaaggttttgggtaagagtatggtgtctctcttgtttatgtggttgttctagcctcgatgtggacggttccccaagctcccc-cagtg 1091  T
158 tcccaaca 165  Q
     |||||||    
1090 acccaaca 1083  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0391; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 58 - 99
Target Start/End: Complemental strand, 1774 - 1733
Alignment:
58 aacccattgccttaaggtttttgataagagtgtggtgtctct 99  Q
    ||||||||||||||||||||||| ||||||||||||||||||    
1774 aacccattgccttaaggtttttggtaagagtgtggtgtctct 1733  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 52; Significance: 1e-20; HSPs: 38)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 58 - 165
Target Start/End: Complemental strand, 45494057 - 45493951
Alignment:
58 aacccattgccttaaggtttttgataagagtgtggtgtctcttttgcttatgtggttgttctatcctcaatgtggatgatcccccgagctcccctcagtg 157  Q
    ||||||||||||||| ||||| |||||||||||||||||||| || ||||||||||||||| | |||| ||||||| | |||||| |||||||| || ||    
45494057 aacccattgccttaaagttttggataagagtgtggtgtctctcttccttatgtggttgttcaagcctcgatgtggacggtccccc-agctccccccaatg 45493959  T
158 tcccaaca 165  Q
     |||||||    
45493958 acccaaca 45493951  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 58 - 151
Target Start/End: Original strand, 41142447 - 41142541
Alignment:
58 aacccattgccttaaggtttttgataa-gagtgtggtgtctcttttgcttatgtggttgttctatcctcaatgtggatgatcccccgagctcccc 151  Q
    ||||||||||||||||||||||| ||| |||||||| |||||| |||||| ||||||||||||| |||| ||||||| | ||||||||| |||||    
41142447 aacccattgccttaaggtttttggtaaagagtgtggcgtctctcttgcttgtgtggttgttctagcctcgatgtggacggtcccccgagttcccc 41142541  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 61 - 133
Target Start/End: Original strand, 41759561 - 41759633
Alignment:
61 ccattgccttaaggtttttgataagagtgtggtgtctcttttgcttatgtggttgttctatcctcaatgtgga 133  Q
    |||||||||||||||||| | |||||||||||||||||| |||||||||||||||||||| |||  |||||||    
41759561 ccattgccttaaggttttgggtaagagtgtggtgtctctcttgcttatgtggttgttctagccttgatgtgga 41759633  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #4
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 58 - 165
Target Start/End: Complemental strand, 44290908 - 44290800
Alignment:
58 aacccattgccttaaggtttttgataa-gagtgtggtgtctcttttgcttatgtggttgttctatcctcaatgtggatgatcccccgagctcccctcagt 156  Q
    ||||||||||||||||||||| | ||| ||||||||||| ||| |||||| || |||||||||| |||| ||||||| | ||||||||||||||| || |    
44290908 aacccattgccttaaggttttgggtaaagagtgtggtgtatctcttgcttgtgcggttgttctagcctcgatgtggacggtcccccgagctccccccact 44290809  T
157 gtcccaaca 165  Q
    | |||||||    
44290808 gacccaaca 44290800  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #5
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 58 - 153
Target Start/End: Complemental strand, 26661981 - 26661886
Alignment:
58 aacccattgccttaaggtttttgataagagtgtggtgtctcttttgcttatgtggttgttctatcctcaatgtggatgatcccccgagctcccctc 153  Q
    |||| |||||||||||||||| | |||||||||||||||||| |||||| ||||||||||| |||||  ||| ||||| || ||| ||||||||||    
26661981 aaccgattgccttaaggttttgggtaagagtgtggtgtctctcttgcttgtgtggttgttcaatccttgatgcggatggtctccctagctcccctc 26661886  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #6
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 62 - 165
Target Start/End: Original strand, 40082485 - 40082588
Alignment:
62 cattgccttaaggtttttgataagagtgtggtgtctcttttgcttatgtggttgttctatcctcaatgtggatgatcccccgagctcccctcagtgtccc 161  Q
    ||||||||||||||||| | |||||||||||| ||||| |||||| || | |||||||| |||| ||||||||  ||| ||||||||||| ||||| |||    
40082485 cattgccttaaggttttgggtaagagtgtggtatctctcttgcttgtgcgtttgttctagcctcgatgtggatagtcctccgagctccccccagtgaccc 40082584  T
162 aaca 165  Q
    ||||    
40082585 aaca 40082588  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #7
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 58 - 165
Target Start/End: Complemental strand, 44290541 - 44290435
Alignment:
58 aacccattgccttaaggtttttgataagagtgtggtgtctcttttgcttatgtggttgttctatcctcaatgtggatgatcccccgagctcccctcagtg 157  Q
    ||||||||||||||||||||| | ||||||| |||||||| | |||||| |  |||||||||| |||| ||||||| | ||||||||||||||| |||||    
44290541 aacccattgccttaaggttttgggtaagagtatggtgtctttcttgcttgtacggttgttctagcctcgatgtggacggtcccccgagctcccc-cagtg 44290443  T
158 tcccaaca 165  Q
     |||||||    
44290442 acccaaca 44290435  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #8
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 66 - 130
Target Start/End: Complemental strand, 5320040 - 5319976
Alignment:
66 gccttaaggtttttgataagagtgtggtgtctcttttgcttatgtggttgttctatcctcaatgt 130  Q
    ||||||||||||| | ||||||||| |||||||| |||||||||||||||||||| |||||||||    
5320040 gccttaaggttttgggtaagagtgtagtgtctctcttgcttatgtggttgttctagcctcaatgt 5319976  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #9
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 58 - 153
Target Start/End: Original strand, 17294652 - 17294748
Alignment:
58 aacccattgccttaaggtttttgataagagtgtggtgtctcttttgcttatg-tggttgttctatcctcaatgtggatgatcccccgagctcccctc 153  Q
    ||||||||||||||||||||| | |||||||||||||||||| | |||||||  ||||| |||| |||| ||||||| | || ||||||||||||||    
17294652 aacccattgccttaaggttttgggtaagagtgtggtgtctctctcgcttatgcaggttgctctagcctcgatgtggacggtcgcccgagctcccctc 17294748  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #10
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 58 - 165
Target Start/End: Original strand, 34364582 - 34364688
Alignment:
58 aacccattgccttaaggtttttgataagagtgtggtgtctcttttgcttatgtggttgttctatcctcaatgtggatgatcccccgagctcccctcagtg 157  Q
    ||||||| ||||||||||||| | |||||||||| ||||||| | ||||||| ||||| |||| |||| ||||||||| | ||| ||||||||| |||||    
34364582 aacccatagccttaaggttttgggtaagagtgtgatgtctctctcgcttatgcggttgctctagcctcgatgtggatggttccctgagctcccc-cagtg 34364680  T
158 tcccaaca 165  Q
     |||||||    
34364681 acccaaca 34364688  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #11
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 58 - 132
Target Start/End: Original strand, 37556186 - 37556260
Alignment:
58 aacccattgccttaaggtttttgataagagtgtggtgtctcttttgcttatgtggttgttctatcctcaatgtgg 132  Q
    ||||||| ||||||||||||| | |||||||||||||||||| |||||| ||||||||||| | |||| ||||||    
37556186 aacccatagccttaaggttttgggtaagagtgtggtgtctctcttgcttgtgtggttgttcaagcctcgatgtgg 37556260  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #12
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 62 - 120
Target Start/End: Complemental strand, 39066279 - 39066221
Alignment:
62 cattgccttaaggtttttgataagagtgtggtgtctcttttgcttatgtggttgttcta 120  Q
    ||||| ||||||||||| |||||||||||||||||||| || |||||||||||||||||    
39066279 cattgtcttaaggttttggataagagtgtggtgtctctcttacttatgtggttgttcta 39066221  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #13
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 62 - 132
Target Start/End: Original strand, 41157070 - 41157140
Alignment:
62 cattgccttaaggtttttgataagagtgtggtgtctcttttgcttatgtggttgttctatcctcaatgtgg 132  Q
    |||||| |||||||||| | |||||||||||||||||| |||||| ||||||||||||| |||| ||||||    
41157070 cattgctttaaggttttgggtaagagtgtggtgtctctattgcttgtgtggttgttctagcctcgatgtgg 41157140  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #14
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 63 - 144
Target Start/End: Original strand, 14318947 - 14319028
Alignment:
63 attgccttaaggtttttgataagagtgtggtgtctcttttgcttatgtggttgttctatcctcaatgtggatgatcccccga 144  Q
    |||||||||||||||| | |||||||||||||||||| ||  || || |||||||||| |||||||||||| | ||||||||    
14318947 attgccttaaggttttgggtaagagtgtggtgtctctcttatttgtgcggttgttctagcctcaatgtggacggtcccccga 14319028  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #15
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 58 - 154
Target Start/End: Complemental strand, 3875414 - 3875318
Alignment:
58 aacccattgccttaaggtttttgataagagtgtggtgtctcttttgcttatgtggttgttctatcctcaatgtggatgatcccccgagctcccctca 154  Q
    ||||||||||||||||||||| | ||||| ||||| |||||| |  ||  ||||||||||||| |||| ||||||| | ||| ||||||||||||||    
3875414 aacccattgccttaaggttttaggtaagaatgtggagtctctctcactagtgtggttgttctagcctcgatgtggacggtcctccgagctcccctca 3875318  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #16
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 58 - 133
Target Start/End: Complemental strand, 3537682 - 3537607
Alignment:
58 aacccattgccttaaggtttttgataagagtgtggtgtctcttttgcttatgtggttgttctatcctcaatgtgga 133  Q
    ||||||||| ||||||||||| | ||||||||||| |||||| |||||| || |||||||||| |||| |||||||    
3537682 aacccattggcttaaggttttgggtaagagtgtggcgtctctcttgcttgtgcggttgttctagcctcgatgtgga 3537607  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #17
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 58 - 125
Target Start/End: Original strand, 29798274 - 29798341
Alignment:
58 aacccattgccttaaggtttttgataagagtgtggtgtctcttttgcttatgtggttgttctatcctc 125  Q
    |||||||||||||||||| || |||||||||||||||||||| ||||   ||||||||||||| ||||    
29798274 aacccattgccttaaggtcttggataagagtgtggtgtctctcttgcaagtgtggttgttctaacctc 29798341  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #18
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 58 - 133
Target Start/End: Complemental strand, 32168781 - 32168706
Alignment:
58 aacccattgccttaaggtttttgataagagtgtggtgtctcttttgcttatgtggttgttctatcctcaatgtgga 133  Q
    ||||||||||||| ||||||| | ||||||||||| |||||| |||||| || |||||||||| |||| |||||||    
32168781 aacccattgccttgaggttttgggtaagagtgtggcgtctctcttgcttgtgcggttgttctagcctcgatgtgga 32168706  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #19
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 66 - 132
Target Start/End: Original strand, 37555812 - 37555878
Alignment:
66 gccttaaggtttttgataagagtgtggtgtctcttttgcttatgtggttgttctatcctcaatgtgg 132  Q
    ||||||||||||| | |||||||||||||||||| |||||| ||||||||||| | |||| ||||||    
37555812 gccttaaggttttgggtaagagtgtggtgtctctcttgcttgtgtggttgttcaagcctcgatgtgg 37555878  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #20
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 58 - 132
Target Start/End: Original strand, 41157450 - 41157524
Alignment:
58 aacccattgccttaaggtttttgataagagtgtggtgtctcttttgcttatgtggttgttctatcctcaatgtgg 132  Q
    ||||||||||||| |||||||   |||||||||||||||| | |||||| ||||||||||||| |||| ||||||    
41157450 aacccattgcctttaggttttgagtaagagtgtggtgtctgtcttgcttgtgtggttgttctagcctcgatgtgg 41157524  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #21
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 58 - 135
Target Start/End: Original strand, 34365000 - 34365077
Alignment:
58 aacccattgccttaaggtttttgataagagtgtggtgtctcttttgcttatgtggttgttctatcctcaatgtggatg 135  Q
    ||||||| ||||||||||||| | |||||||||||||||||| | |||||||  |||| |||| |||| |||||||||    
34365000 aacccatagccttaaggttttgggtaagagtgtggtgtctctctcgcttatgcagttgctctaacctcgatgtggatg 34365077  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #22
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 68 - 153
Target Start/End: Complemental strand, 50052096 - 50052012
Alignment:
68 cttaaggtttttgataagagtgtggtgtctcttttgcttatgtggttgttctatcctcaatgtggatgatcccccgagctcccctc 153  Q
    ||||| ||||| | |||||||||||||||||| ||| |||||| ||||||||| |||| |||||||   |||||||||||||||||    
50052096 cttaaagttttgggtaagagtgtggtgtctctcttgtttatgt-gttgttctaacctcgatgtggacagtcccccgagctcccctc 50052012  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #23
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 65 - 149
Target Start/End: Original strand, 11977026 - 11977110
Alignment:
65 tgccttaaggtttttgataagagtgtggtgtctcttttgcttatgtggttgttctatcctcaatgtggatgatcccccgagctcc 149  Q
    |||||||||||||| | |||||||||||||||||| ||||   || ||| |||||| |||| ||||||| | |||||||||||||    
11977026 tgccttaaggttttgggtaagagtgtggtgtctctcttgcaagtgcggtagttctagcctcgatgtggacggtcccccgagctcc 11977110  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #24
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 81 - 165
Target Start/End: Complemental strand, 21378119 - 21378036
Alignment:
81 ataagagtgtggtgtctcttttgcttatgtggttgttctatcctcaatgtggatgatcccccgagctcccctcagtgtcccaaca 165  Q
    |||||||||||| |||| | |||||| ||||||||||||| |||||||||||| | ||||| | ||||||| ||||| |||||||    
21378119 ataagagtgtggcgtctatattgcttgtgtggttgttctagcctcaatgtggacggtcccctgcgctcccc-cagtgacccaaca 21378036  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #25
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 62 - 118
Target Start/End: Complemental strand, 26661601 - 26661545
Alignment:
62 cattgccttaaggtttttgataagagtgtggtgtctcttttgcttatgtggttgttc 118  Q
    ||||||||||||||||| | |||||||||||||||||| | |||| |||||||||||    
26661601 cattgccttaaggttttgggtaagagtgtggtgtctctctcgcttgtgtggttgttc 26661545  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #26
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 62 - 133
Target Start/End: Complemental strand, 48588567 - 48588496
Alignment:
62 cattgccttaaggtttttgataagagtgtggtgtctcttttgcttatgtggttgttctatcctcaatgtgga 133  Q
    ||||||||||||||||| | |||||||| ||||||||| || ||| || |||||||||| |||| |||||||    
48588567 cattgccttaaggttttgggtaagagtgcggtgtctctcttacttgtgcggttgttctagcctcgatgtgga 48588496  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #27
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 58 - 153
Target Start/End: Complemental strand, 50051771 - 50051677
Alignment:
58 aacccattgccttaaggtttttgataagagtgtggtgtctcttttgcttatgtggttgttctatcctcaatgtggatgatcccccgagctcccctc 153  Q
    ||||||||  |||||||||||   |||||||||||||||||| ||| |||||| ||||||||| | || ||||||| | |||||| ||||||||||    
50051771 aacccattatcttaaggttttgcgtaagagtgtggtgtctctcttgtttatgt-gttgttctagcatcgatgtggacggtccccctagctcccctc 50051677  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #28
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 65 - 143
Target Start/End: Original strand, 34649520 - 34649598
Alignment:
65 tgccttaaggtttttgataagagtgtggtgtctcttttgcttatgtggttgttctatcctcaatgtggatgatcccccg 143  Q
    |||||||||||||| | |||||||| || |||||| |||||  ||||||||||||| |||| ||||||| | |||||||    
34649520 tgccttaaggttttgggtaagagtgaggcgtctctcttgctagtgtggttgttctagcctcgatgtggacggtcccccg 34649598  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #29
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 58 - 131
Target Start/End: Original strand, 9955984 - 9956057
Alignment:
58 aacccattgccttaaggtttttgataagagtgtggtgtctcttttgcttatgtggttgttctatcctcaatgtg 131  Q
    |||| |||||||||||||||| | |||||||||| ||||||| |||||| || ||||| |||| |||| |||||    
9955984 aaccaattgccttaaggttttgggtaagagtgtgatgtctctcttgcttgtgcggttgctctagcctcgatgtg 9956057  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #30
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 65 - 154
Target Start/End: Complemental strand, 31767237 - 31767148
Alignment:
65 tgccttaaggtttttgataagagtgtggtgtctcttttgcttatgtggttgttctatcctcaatgtggatgatcccccgagctcccctca 154  Q
    |||||||||||||| | ||||||||||  |||| | |||||| |||||||||||||  ||| ||||||| | |||||| |||| ||||||    
31767237 tgccttaaggttttgggtaagagtgtgacgtctatcttgcttgtgtggttgttctagactcgatgtggacggtcccccaagcttccctca 31767148  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #31
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 68 - 152
Target Start/End: Complemental strand, 5528827 - 5528743
Alignment:
68 cttaaggtttttgataagagtgtggtgtctcttttgcttatgtggttgttctatcctcaatgtggatgatcccccgagctcccct 152  Q
    ||||||||||| | |||  |||||| |||||| ||  ||||| ||||||||||||||| |||||||||| ||||||  |||||||    
5528827 cttaaggttttgggtaaatgtgtggcgtctctcttctttatgcggttgttctatcctcgatgtggatgaccccccggactcccct 5528743  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #32
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 58 - 105
Target Start/End: Original strand, 3550795 - 3550842
Alignment:
58 aacccattgccttaaggtttttgataagagtgtggtgtctcttttgct 105  Q
    ||||||||||||||| ||||| | |||||||||||||||||| |||||    
3550795 aacccattgccttaaagttttgggtaagagtgtggtgtctctcttgct 3550842  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #33
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 65 - 144
Target Start/End: Original strand, 11977362 - 11977441
Alignment:
65 tgccttaaggtttttgataagagtgtggtgtctcttttgcttatgtggttgttctatcctcaatgtggatgatcccccga 144  Q
    |||||||||||||| | |||||||||| ||||||| ||||   || |||||||||| |||| ||||||| | ||||||||    
11977362 tgccttaaggttttgggtaagagtgtgatgtctctcttgcaagtgcggttgttctagcctcgatgtggacggtcccccga 11977441  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #34
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 58 - 125
Target Start/End: Complemental strand, 38804438 - 38804371
Alignment:
58 aacccattgccttaaggtttttgataagagtgtggtgtctcttttgcttatgtggttgttctatcctc 125  Q
    |||||||  |||||||||||| | ||||||||| |||||||| |||||| || |||||||||| ||||    
38804438 aacccataaccttaaggttttgggtaagagtgtagtgtctctcttgcttgtgcggttgttctagcctc 38804371  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #35
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 65 - 99
Target Start/End: Original strand, 12466365 - 12466399
Alignment:
65 tgccttaaggtttttgataagagtgtggtgtctct 99  Q
    |||||||||||||||| ||||||||||||||||||    
12466365 tgccttaaggtttttggtaagagtgtggtgtctct 12466399  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #36
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 68 - 142
Target Start/End: Original strand, 45084461 - 45084535
Alignment:
68 cttaaggtttttgataagagtgtggtgtctcttttgcttatgtggttgttctatcctcaatgtggatgatccccc 142  Q
    ||||||||||| | |||||| ||||||||||| |||||| || |||||||||| |||| ||| ||| | ||||||    
45084461 cttaaggttttgggtaagagagtggtgtctctcttgcttgtgcggttgttctaacctcgatgcggacggtccccc 45084535  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #37
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 19 - 60
Target Start/End: Original strand, 37556121 - 37556162
Alignment:
19 agttatatgtctcacatcgcttaaaaatagtaaaggttgaac 60  Q
    ||||||||||| |||||||  |||||||||||||||||||||    
37556121 agttatatgtcccacatcggataaaaatagtaaaggttgaac 37556162  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #38
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 58 - 111
Target Start/End: Complemental strand, 44043855 - 44043802
Alignment:
58 aacccattgccttaaggtttttgataagagtgtggtgtctcttttgcttatgtg 111  Q
    ||||||||| |||||| |||| | |||||||||||||||||| ||| |||||||    
44043855 aacccattgtcttaagattttgggtaagagtgtggtgtctctcttgtttatgtg 44043802  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0702 (Bit Score: 48; Significance: 3e-18; HSPs: 2)
Name: scaffold0702
Description:

Target: scaffold0702; HSP #1
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 58 - 165
Target Start/End: Complemental strand, 597 - 491
Alignment:
58 aacccattgccttaaggtttttgataagagtgtggtgtctcttttgcttatgtggttgttctatcctcaatgtggatgatcccccgagctcccctcagtg 157  Q
    ||||||||||||||||||||| | |||||||||||||||| | ||||||  |||||| ||||| |||| ||||||| | ||||||||||| ||| |||||    
597 aacccattgccttaaggttttgggtaagagtgtggtgtctttcttgcttgagtggtttttctagcctcgatgtggaaggtcccccgagcttccc-cagtg 499  T
158 tcccaaca 165  Q
     |||||||    
498 acccaaca 491  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0702; HSP #2
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 82 - 147
Target Start/End: Complemental strand, 206 - 141
Alignment:
82 taagagtgtggtgtctcttttgcttatgtggttgttctatcctcaatgtggatgatcccccgagct 147  Q
    ||||| |||||||||||| ||||||  |||||||||||| |||| ||||||| | |||||||||||    
206 taagaatgtggtgtctctcttgcttgagtggttgttctagcctcgatgtggacggtcccccgagct 141  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0078 (Bit Score: 36; Significance: 0.00000000004; HSPs: 2)
Name: scaffold0078
Description:

Target: scaffold0078; HSP #1
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 62 - 133
Target Start/End: Original strand, 5061 - 5132
Alignment:
62 cattgccttaaggtttttgataagagtgtggtgtctcttttgcttatgtggttgttctatcctcaatgtgga 133  Q
    |||||||||| |||||| | |||||||||||||||||| | ||||||| ||||| |||| |||| |||||||    
5061 cattgccttatggttttgggtaagagtgtggtgtctctctcgcttatgcggttgctctagcctcgatgtgga 5132  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0078; HSP #2
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 58 - 99
Target Start/End: Original strand, 5432 - 5473
Alignment:
58 aacccattgccttaaggtttttgataagagtgtggtgtctct 99  Q
    |||||||||||||||| |||| ||||||||||||||||||||    
5432 aacccattgccttaagattttggataagagtgtggtgtctct 5473  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0027 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: scaffold0027
Description:

Target: scaffold0027; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 58 - 142
Target Start/End: Original strand, 47435 - 47519
Alignment:
58 aacccattgccttaaggtttttgataagagtgtggtgtctcttttgcttatgtggttgttctatcctcaatgtggatgatccccc 142  Q
    ||||||||||||||| ||||| | ||| | |||||||||||| ||||||  | |||||||||| |||| ||||||| | ||||||    
47435 aacccattgccttaaagttttgggtaaaaatgtggtgtctctcttgcttgcgcggttgttctaacctcgatgtggacggtccccc 47519  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University