View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19971_high_25 (Length: 388)
Name: NF19971_high_25
Description: NF19971
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19971_high_25 |
 |  |
|
| [»] scaffold0721 (1 HSPs) |
 |  |  |
|
| [»] scaffold0394 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr7 (Bit Score: 330; Significance: 0; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 330; E-Value: 0
Query Start/End: Original strand, 14 - 370
Target Start/End: Original strand, 31436833 - 31437187
Alignment:
| Q |
14 |
ataatactctttctgctctagtattcctcaatttccgaaagaaatctaaatggctccctcaaaatcaaaagtgaaacatgtgttattgttcctaagtttc |
113 |
Q |
| |
|
|||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31436833 |
ataatactctttctgctctatta--cctcaatttccgaaagaaatctaaatggctccctcaaaatcaaaagtgaaacatgtgttattgttcctaagtttc |
31436930 |
T |
 |
| Q |
114 |
tatattctccaaatgaccattggagacgatggcactttcatgtcaaagctagcaaaatctttgagtcctactccgtcaggttggtcaactagcagcaact |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
31436931 |
tatattctccaaatgaccattggagacgatggcactttcatgtcaaagctagcaaaatctttgagtcctactccgtcaggttggtcaattagcagcaact |
31437030 |
T |
 |
| Q |
214 |
tctgcacctggaacggtgtaaaatgtgaccaagcacatcgagtaacatctatcgacctttcttccaagtcactcaatggaacacttccttccgatctcaa |
313 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31437031 |
tctgcacctggaacggtgtaaaatgtgaccaagcacaccgagtaacatctatcgacctttcttccaagtcactcaatggaacacttccttccgatctcaa |
31437130 |
T |
 |
| Q |
314 |
ctcgctctcccaactcaccgccctctttcttcagtccaactctctttctggcgcatt |
370 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31437131 |
ctcgctctcccaactcacctccctctttcttcagtccaactctctttctggcgcatt |
31437187 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0721 (Bit Score: 46; Significance: 4e-17; HSPs: 1)
Name: scaffold0721
Description:
Target: scaffold0721; HSP #1
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 131 - 200
Target Start/End: Complemental strand, 6256 - 6187
Alignment:
| Q |
131 |
cattggagacgatggcactttcatgtcaaagctagcaaaatctttgagtcctactccgtcaggttggtca |
200 |
Q |
| |
|
||||| ||| ||||||||||||||||||||||| |||||||| ||||||||||| || |||||||||||| |
|
|
| T |
6256 |
cattgcagatgatggcactttcatgtcaaagctggcaaaatccttgagtcctacaccatcaggttggtca |
6187 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0394 (Bit Score: 46; Significance: 4e-17; HSPs: 1)
Name: scaffold0394
Description:
Target: scaffold0394; HSP #1
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 131 - 200
Target Start/End: Complemental strand, 2775 - 2706
Alignment:
| Q |
131 |
cattggagacgatggcactttcatgtcaaagctagcaaaatctttgagtcctactccgtcaggttggtca |
200 |
Q |
| |
|
||||| ||| ||||||||||||||||||||||| |||||||| ||||||||||| || |||||||||||| |
|
|
| T |
2775 |
cattgcagatgatggcactttcatgtcaaagctggcaaaatccttgagtcctacaccatcaggttggtca |
2706 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 46; Significance: 4e-17; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 131 - 200
Target Start/End: Original strand, 15061284 - 15061353
Alignment:
| Q |
131 |
cattggagacgatggcactttcatgtcaaagctagcaaaatctttgagtcctactccgtcaggttggtca |
200 |
Q |
| |
|
||||| ||| ||||||||||||||||||||||| |||||||| ||||||||||| || |||||||||||| |
|
|
| T |
15061284 |
cattgcagatgatggcactttcatgtcaaagctggcaaaatccttgagtcctacaccatcaggttggtca |
15061353 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 255 - 316
Target Start/End: Original strand, 15061408 - 15061469
Alignment:
| Q |
255 |
gtaacatctatcgacctttcttccaagtcactcaatggaacacttccttccgatctcaactc |
316 |
Q |
| |
|
|||||||||||| | ||| |||||| |||||| | ||||||| ||||||| ||||||||||| |
|
|
| T |
15061408 |
gtaacatctatcaagcttgcttccatgtcacttattggaacaattccttctgatctcaactc |
15061469 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University