View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19971_high_44 (Length: 283)
Name: NF19971_high_44
Description: NF19971
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19971_high_44 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 107; Significance: 1e-53; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 107; E-Value: 1e-53
Query Start/End: Original strand, 26 - 132
Target Start/End: Complemental strand, 47574428 - 47574322
Alignment:
| Q |
26 |
aatcctttcttatcacaataaagtttgtcacacttaactatttttgtgttgcagctgtgccgcgatctgttgctgctgcgccatggaggagctttgtttc |
125 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47574428 |
aatcctttcttatcacaataaagtttgtcacacttaactatttttgtgttgcagctgtgccgcgatctgttgctgctgcgccatggaggagctttgtttc |
47574329 |
T |
 |
| Q |
126 |
taataat |
132 |
Q |
| |
|
||||||| |
|
|
| T |
47574328 |
taataat |
47574322 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 46 - 126
Target Start/End: Complemental strand, 47569490 - 47569410
Alignment:
| Q |
46 |
aagtttgtcacacttaactatttttgtgttgcagctgtgccgcgatctgttgctgctgcgccatggaggagctttgtttct |
126 |
Q |
| |
|
|||||||||| |||| ||||||||||||||||||||||||||| | |||||||||||||||||||||||| |||||||| |
|
|
| T |
47569490 |
aagtttgtcaaactttgctatttttgtgttgcagctgtgccgcgctttgttgctgctgcgccatggaggagtgttgtttct |
47569410 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 52; E-Value: 7e-21
Query Start/End: Original strand, 216 - 267
Target Start/End: Complemental strand, 47574321 - 47574270
Alignment:
| Q |
216 |
gctattgagagatctatttggtgttgttattccctagttattttcatggagt |
267 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47574321 |
gctattgagagatctatttggtgttgttattccctagttattttcatggagt |
47574270 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University