View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19971_high_61 (Length: 203)
Name: NF19971_high_61
Description: NF19971
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19971_high_61 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 114; Significance: 5e-58; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 114; E-Value: 5e-58
Query Start/End: Original strand, 20 - 149
Target Start/End: Complemental strand, 41891242 - 41891113
Alignment:
| Q |
20 |
ttgcaatcattggatattggacttttggacaagatgttaatgataatatactaatgtcacttgaaaaaccttcatggcttattgcctctgctaacttgat |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41891242 |
ttgcaatcattggatattggacttttggacaagatgttaatgataatatactaatgtcacttgaaaaaccttcatggcttattgcctctgctaacttgat |
41891143 |
T |
 |
| Q |
120 |
ggtatttattcatgttgttggaagttatca |
149 |
Q |
| |
|
|||||| || ||||||||||| || ||||| |
|
|
| T |
41891142 |
ggtattcatccatgttgttggtagctatca |
41891113 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 63; E-Value: 1e-27
Query Start/End: Original strand, 31 - 125
Target Start/End: Complemental strand, 41896807 - 41896713
Alignment:
| Q |
31 |
ggatattggacttttggacaagatgttaatgataatatactaatgtcacttgaaaaaccttcatggcttattgcctctgctaacttgatggtatt |
125 |
Q |
| |
|
||||||||| ||||||||||||||||| ||||||| ||||| ||||||||||||| ||||||||||||| |||| |||||||| ||||||||||| |
|
|
| T |
41896807 |
ggatattgggcttttggacaagatgttgatgataacatacttatgtcacttgaaagaccttcatggcttgttgcttctgctaatttgatggtatt |
41896713 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 151 - 188
Target Start/End: Complemental strand, 41890888 - 41890851
Alignment:
| Q |
151 |
gtttatgctatgcctgtttttgatttgattgagaggat |
188 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
41890888 |
gtttatgcaatgcctgtttttgatttgattgagaggat |
41890851 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 101; Significance: 3e-50; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 101; E-Value: 3e-50
Query Start/End: Original strand, 28 - 188
Target Start/End: Original strand, 22550700 - 22550860
Alignment:
| Q |
28 |
attggatattggacttttggacaagatgttaatgataatatactaatgtcacttgaaaaaccttcatggcttattgcctctgctaacttgatggtattta |
127 |
Q |
| |
|
|||||||||||| | |||||| ||||||| | |||||| | || ||||||||||||| ||| | ||||| |||||||||||||||||||||||||| | |
|
|
| T |
22550700 |
attggatattgggcatttggaagagatgttgaagataatgtgcttatgtcacttgaaagaccagcttggctcattgcctctgctaacttgatggtattca |
22550799 |
T |
 |
| Q |
128 |
ttcatgttgttggaagttatcaagtttatgctatgcctgtttttgatttgattgagaggat |
188 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22550800 |
ttcatgttgttggaagttatcaagtttatgctatgcctgtttttgatttgattgagaggat |
22550860 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University